EMAIL THIS PAGE TO A FRIEND

LRTOMT

leucine rich transmembrane and O-methyltransferase domain containing

100 Gene Product Result for
Synonyms: DFNB63 LRRC51
UniProtKB ID: Q8WZ04, B7Z816
Gene ID:
Human(220074) Summary: This gene includes two transcript forms. The short form has one open reading frame (ORF), which encodes the leucine-rich repeats (LRR)-containing protein of unknown function. This protein is called LRTOMT1 or LRRC51. The long form has two alternative ORFs; the upstream ORF has the same translation start codon as used in the short form and the resulting transcript is a candidate for nonsense-mediated decay, and the downstream ORF encodes a different protein, which is a transmembrane catechol-O-methyltransferase and is called LRTOMT2, TOMT or COMT2. The COMT2 is essential for auditory and vestibular function. Defects in the COMT2 can cause nonsyndromic deafness. Alternatively spliced transcript variants from each transcript form have been found for this gene. [provided by RefSeq, Sep 2012]
Zebrafish(767801) leucine rich transmembrane and O-methyltransferase domain containing
dog(485212) leucine rich transmembrane and O-methyltransferase domain containing
chicken(100857436) transmembrane O-methyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145309 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145309 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145309 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145309 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133970 predicted 606
2 SASI_Hs01_00133971 predicted 408
3 SASI_Hs02_00365209 predicted 230
4 SASI_Hs02_00365210 predicted 408
5 SASI_Hs01_00133975 predicted 329
6 SASI_Hs02_00365211 predicted 325
7 SASI_Hs02_00365212 predicted 582
8 SASI_Hs01_00133979 predicted 236
9 SASI_Hs02_00365213 predicted 268
10 SASI_Hs02_00365214 predicted 278
11 SASI_Hs01_00133972 predicted 209
12 SASI_Hs01_00133973 predicted 404
13 SASI_Hs01_00133974 predicted 630
14 SASI_Hs01_00133976 predicted 451
15 SASI_Hs01_00133977 predicted 475
16 SASI_Hs01_00133978 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145309
VALIDATED
LRTOMT MISSION shRNA Bacterial Glycerol Stock
leucine rich transmembrane and O-methyltransferase domain containing
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145309.2-998s21c1
Sequence:CCGGACAGCATGGTTTGACAATAAACTCGAGTTTATTGTCAAACCATGCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145309.2-936s21c1
Sequence:CCGGGACCAAGCAGAATACACTTTGCTCGAGCAAAGTGTATTCTGCTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145309.1-696s1c1
Sequence:CCGGGCATGAACATCAAGCCCAAGACTCGAGTCTTGGGCTTGATGTTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_145309.1-590s1c1
Sequence:CCGGGAGAAAGGGTATAGGCAATATCTCGAGATATTGCCTATACCCTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_145309.1-238s1c1
Sequence:CCGGCGTCATTCAAGATCTGGTAAACTCGAGTTTACCAGATCTTGAATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145309.1-587s1c1
Sequence:CCGGGAAGAGAAAGGGTATAGGCAACTCGAGTTGCCTATACCCTTTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_145309.1-844s1c1
Sequence:CCGGCCTTGTAGAGATGTTCTCTAACTCGAGTTAGAGAACATCTCTACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145309.1-349s1c1
Sequence:CCGGCAATGATCTGAGAGACTTCAACTCGAGTTGAAGTCTCTCAGATCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145309.1-457s1c1
Sequence:CCGGCCTAACAACTTTCTTCAACCTCTCGAGAGGTTGAAGAAAGTTGTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145309.1-210s1c1
Sequence:CCGGCTCTTGACTACTCCTTCAGAACTCGAGTTCTGAAGGAGTAGTCAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_145309.1-451s1c1
Sequence:CCGGCCCTGTCCTAACAACTTTCTTCTCGAGAAGAAAGTTGTTAGGACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145309
VALIDATED
LRTOMT MISSION shRNA shRNA Plasmid DNA
leucine rich transmembrane and O-methyltransferase domain containing
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145309.2-998s21c1
Sequence:CCGGACAGCATGGTTTGACAATAAACTCGAGTTTATTGTCAAACCATGCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145309.2-936s21c1
Sequence:CCGGGACCAAGCAGAATACACTTTGCTCGAGCAAAGTGTATTCTGCTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145309.1-696s1c1
Sequence:CCGGGCATGAACATCAAGCCCAAGACTCGAGTCTTGGGCTTGATGTTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_145309.1-590s1c1
Sequence:CCGGGAGAAAGGGTATAGGCAATATCTCGAGATATTGCCTATACCCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_145309.1-238s1c1
Sequence:CCGGCGTCATTCAAGATCTGGTAAACTCGAGTTTACCAGATCTTGAATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145309.1-587s1c1
Sequence:CCGGGAAGAGAAAGGGTATAGGCAACTCGAGTTGCCTATACCCTTTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_145309.1-844s1c1
Sequence:CCGGCCTTGTAGAGATGTTCTCTAACTCGAGTTAGAGAACATCTCTACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145309.1-349s1c1
Sequence:CCGGCAATGATCTGAGAGACTTCAACTCGAGTTGAAGTCTCTCAGATCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145309.1-457s1c1
Sequence:CCGGCCTAACAACTTTCTTCAACCTCTCGAGAGGTTGAAGAAAGTTGTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145309.1-210s1c1
Sequence:CCGGCTCTTGACTACTCCTTCAGAACTCGAGTTCTGAAGGAGTAGTCAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_145309.1-451s1c1
Sequence:CCGGCCCTGTCCTAACAACTTTCTTCTCGAGAAGAAAGTTGTTAGGACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145309
VALIDATED
LRTOMT MISSION shRNA Lentiviral Transduction Particles
leucine rich transmembrane and O-methyltransferase domain containing
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145309.2-998s21c1
Sequence:CCGGACAGCATGGTTTGACAATAAACTCGAGTTTATTGTCAAACCATGCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145309.2-936s21c1
Sequence:CCGGGACCAAGCAGAATACACTTTGCTCGAGCAAAGTGTATTCTGCTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145309.1-696s1c1
Sequence:CCGGGCATGAACATCAAGCCCAAGACTCGAGTCTTGGGCTTGATGTTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_145309.1-590s1c1
Sequence:CCGGGAGAAAGGGTATAGGCAATATCTCGAGATATTGCCTATACCCTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_145309.1-238s1c1
Sequence:CCGGCGTCATTCAAGATCTGGTAAACTCGAGTTTACCAGATCTTGAATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145309.1-587s1c1
Sequence:CCGGGAAGAGAAAGGGTATAGGCAACTCGAGTTGCCTATACCCTTTCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_145309.1-844s1c1
Sequence:CCGGCCTTGTAGAGATGTTCTCTAACTCGAGTTAGAGAACATCTCTACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145309.1-349s1c1
Sequence:CCGGCAATGATCTGAGAGACTTCAACTCGAGTTGAAGTCTCTCAGATCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145309.1-457s1c1
Sequence:CCGGCCTAACAACTTTCTTCAACCTCTCGAGAGGTTGAAGAAAGTTGTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145309.1-210s1c1
Sequence:CCGGCTCTTGACTACTCCTTCAGAACTCGAGTTCTGAAGGAGTAGTCAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_145309.1-451s1c1
Sequence:CCGGCCCTGTCCTAACAACTTTCTTCTCGAGAAGAAAGTTGTTAGGACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)