EMAIL THIS PAGE TO A FRIEND

LRWD1

leucine-rich repeats and WD repeat domain containing 1

36 Gene Product Result for
Synonyms: CENP-33 ORCA
UniProtKB ID: Q9UFC0, A8K4K2, B2R9G2, Q8N0T9, Q8WV43, Q96GJ2
Gene ID:
Mouse(71735) leucine-rich repeats and WD repeat domain containing 1
Zebrafish(327124) leucine-rich repeats and WD repeat domain containing 1
cow(100138861) leucine-rich repeats and WD repeat domain containing 1
Horse(100060715) leucine-rich repeats and WD repeat domain containing 1
dog(479725) leucine-rich repeats and WD repeat domain containing 1
chicken(417511) leucine-rich repeats and WD repeat domain containing 1
domestic cat(101091169) leucine-rich repeats and WD repeat domain containing 1
sheep(101119102) leucine-rich repeats and WD repeat domain containing 1
domestic guinea pig(100735189) leucine-rich repeats and WD repeat domain containing 1
naked mole-rat(101720943) leucine-rich repeats and WD repeat domain containing 1
Domestic Rabbit(100337872) leucine-rich repeats and WD repeat domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152892 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152892 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152892 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027891 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027891 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027891 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152892 Rosetta Predictions human pricing
NM_027891 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102671 predicted 210
2 SASI_Hs01_00102672 predicted 209
3 SASI_Hs01_00102673 predicted 1627
4 SASI_Hs01_00102674 predicted 817
5 SASI_Hs01_00102675 predicted 285
6 SASI_Hs02_00366861 predicted 521
7 SASI_Hs01_00102676 predicted 1177
8 SASI_Hs01_00102677 predicted 827
9 SASI_Hs01_00102678 predicted 217
10 SASI_Hs01_00102679 predicted 1366
11 SASI_Hs01_00102670 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045672 predicted 1730
2 SASI_Mm01_00045673 predicted 1422
3 SASI_Mm01_00045674 predicted 1849
4 SASI_Mm01_00045675 predicted 1731
5 SASI_Mm01_00045676 predicted 1197
6 SASI_Mm01_00045677 predicted 1852
7 SASI_Mm01_00045679 predicted 1066
8 SASI_Mm02_00332858 predicted 402
9 SASI_Mm02_00332859 predicted 615
10 SASI_Mm02_00332860 predicted 1287
11 SASI_Mm01_00045678 predicted 2538
12 SASI_Mm01_00045680 predicted 2161
13 SASI_Mm01_00045681 predicted 2818
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152892
VALIDATED
LRWD1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and WD repeat domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152892.1-1371s1c1
Sequence:CCGGCTCCTATGACAAGCGGATCATCTCGAGATGATCCGCTTGTCATAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_152892.1-1648s1c1
Sequence:CCGGGCATTTGTGAATGAGGACATCCTCGAGGATGTCCTCATTCACAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152892.1-450s1c1
Sequence:CCGGGACGGTCAATGACAACCTGAACTCGAGTTCAGGTTGTCATTGACCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_152892.1-1125s1c1
Sequence:CCGGCATCGTGCTCCACAAGTACAACTCGAGTTGTACTTGTGGAGCACGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152892.1-1644s1c1
Sequence:CCGGGCTGGCATTTGTGAATGAGGACTCGAGTCCTCATTCACAAATGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152892.1-510s1c1
Sequence:CCGGCAAGGATGCGTCCTCAACTTACTCGAGTAAGTTGAGGACGCATCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152892.1-465s1c1
Sequence:CCGGCCTGAAAGTCTCCTTTCTCCTCTCGAGAGGAGAAAGGAGACTTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_152892.1-496s1c1
Sequence:CCGGCGTAAGGTCAATGGCAAGGATCTCGAGATCCTTGCCATTGACCTTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_152892.1-1639s1c1
Sequence:CCGGGATGGGCTGGCATTTGTGAATCTCGAGATTCACAAATGCCAGCCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152892
VALIDATED
LRWD1 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and WD repeat domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152892.1-1371s1c1
Sequence:CCGGCTCCTATGACAAGCGGATCATCTCGAGATGATCCGCTTGTCATAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_152892.1-1648s1c1
Sequence:CCGGGCATTTGTGAATGAGGACATCCTCGAGGATGTCCTCATTCACAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152892.1-450s1c1
Sequence:CCGGGACGGTCAATGACAACCTGAACTCGAGTTCAGGTTGTCATTGACCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_152892.1-1125s1c1
Sequence:CCGGCATCGTGCTCCACAAGTACAACTCGAGTTGTACTTGTGGAGCACGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152892.1-1644s1c1
Sequence:CCGGGCTGGCATTTGTGAATGAGGACTCGAGTCCTCATTCACAAATGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152892.1-510s1c1
Sequence:CCGGCAAGGATGCGTCCTCAACTTACTCGAGTAAGTTGAGGACGCATCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152892.1-465s1c1
Sequence:CCGGCCTGAAAGTCTCCTTTCTCCTCTCGAGAGGAGAAAGGAGACTTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_152892.1-496s1c1
Sequence:CCGGCGTAAGGTCAATGGCAAGGATCTCGAGATCCTTGCCATTGACCTTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_152892.1-1639s1c1
Sequence:CCGGGATGGGCTGGCATTTGTGAATCTCGAGATTCACAAATGCCAGCCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152892
VALIDATED
LRWD1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and WD repeat domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152892.1-1371s1c1
Sequence:CCGGCTCCTATGACAAGCGGATCATCTCGAGATGATCCGCTTGTCATAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_152892.1-1648s1c1
Sequence:CCGGGCATTTGTGAATGAGGACATCCTCGAGGATGTCCTCATTCACAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152892.1-450s1c1
Sequence:CCGGGACGGTCAATGACAACCTGAACTCGAGTTCAGGTTGTCATTGACCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_152892.1-1125s1c1
Sequence:CCGGCATCGTGCTCCACAAGTACAACTCGAGTTGTACTTGTGGAGCACGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152892.1-1644s1c1
Sequence:CCGGGCTGGCATTTGTGAATGAGGACTCGAGTCCTCATTCACAAATGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152892.1-510s1c1
Sequence:CCGGCAAGGATGCGTCCTCAACTTACTCGAGTAAGTTGAGGACGCATCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152892.1-465s1c1
Sequence:CCGGCCTGAAAGTCTCCTTTCTCCTCTCGAGAGGAGAAAGGAGACTTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_152892.1-496s1c1
Sequence:CCGGCGTAAGGTCAATGGCAAGGATCTCGAGATCCTTGCCATTGACCTTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_152892.1-1639s1c1
Sequence:CCGGGATGGGCTGGCATTTGTGAATCTCGAGATTCACAAATGCCAGCCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027891
VALIDATED
LRWD1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and WD repeat domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027891.1-1916s1c1
Sequence:CCGGCCTGCAGTGTCATAGCAGAAACTCGAGTTTCTGCTATGACACTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027891.1-2817s1c1
Sequence:CCGGAGTGTGTGGATCTATGATGTTCTCGAGAACATCATAGATCCACACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027891.1-2820s1c1
Sequence:CCGGGTGTGGATCTATGATGTTGAACTCGAGTTCAACATCATAGATCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027891.1-1919s1c1
Sequence:CCGGGCAGTGTCATAGCAGAAACAACTCGAGTTGTTTCTGCTATGACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027891.1-2324s1c1
Sequence:CCGGCTCCTACGACAAACGGATCATCTCGAGATGATCCGTTTGTCGTAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027891.4-1858s21c1
Sequence:CCGGGTGTGGATCTATGATGTTGAACTCGAGTTCAACATCATAGATCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027891.4-954s21c1
Sequence:CCGGCCTGCAGTGTCATAGCAGAAACTCGAGTTTCTGCTATGACACTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027891.4-1111s21c1
Sequence:CCGGACAGGCCTCGTACTCCATAAGCTCGAGCTTATGGAGTACGAGGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027891.4-1362s21c1
Sequence:CCGGCTCCTACGACAAACGGATCATCTCGAGATGATCCGTTTGTCGTAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027891
VALIDATED
LRWD1 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and WD repeat domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027891.1-1916s1c1
Sequence:CCGGCCTGCAGTGTCATAGCAGAAACTCGAGTTTCTGCTATGACACTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027891.1-2817s1c1
Sequence:CCGGAGTGTGTGGATCTATGATGTTCTCGAGAACATCATAGATCCACACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027891.1-2820s1c1
Sequence:CCGGGTGTGGATCTATGATGTTGAACTCGAGTTCAACATCATAGATCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027891.1-1919s1c1
Sequence:CCGGGCAGTGTCATAGCAGAAACAACTCGAGTTGTTTCTGCTATGACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027891.1-2324s1c1
Sequence:CCGGCTCCTACGACAAACGGATCATCTCGAGATGATCCGTTTGTCGTAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027891.4-1858s21c1
Sequence:CCGGGTGTGGATCTATGATGTTGAACTCGAGTTCAACATCATAGATCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027891.4-954s21c1
Sequence:CCGGCCTGCAGTGTCATAGCAGAAACTCGAGTTTCTGCTATGACACTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027891.4-1111s21c1
Sequence:CCGGACAGGCCTCGTACTCCATAAGCTCGAGCTTATGGAGTACGAGGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027891.4-1362s21c1
Sequence:CCGGCTCCTACGACAAACGGATCATCTCGAGATGATCCGTTTGTCGTAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027891
VALIDATED
LRWD1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and WD repeat domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027891.1-1916s1c1
Sequence:CCGGCCTGCAGTGTCATAGCAGAAACTCGAGTTTCTGCTATGACACTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027891.1-2817s1c1
Sequence:CCGGAGTGTGTGGATCTATGATGTTCTCGAGAACATCATAGATCCACACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027891.1-2820s1c1
Sequence:CCGGGTGTGGATCTATGATGTTGAACTCGAGTTCAACATCATAGATCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027891.1-1919s1c1
Sequence:CCGGGCAGTGTCATAGCAGAAACAACTCGAGTTGTTTCTGCTATGACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027891.1-2324s1c1
Sequence:CCGGCTCCTACGACAAACGGATCATCTCGAGATGATCCGTTTGTCGTAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027891.4-1858s21c1
Sequence:CCGGGTGTGGATCTATGATGTTGAACTCGAGTTCAACATCATAGATCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027891.4-954s21c1
Sequence:CCGGCCTGCAGTGTCATAGCAGAAACTCGAGTTTCTGCTATGACACTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027891.4-1111s21c1
Sequence:CCGGACAGGCCTCGTACTCCATAAGCTCGAGCTTATGGAGTACGAGGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027891.4-1362s21c1
Sequence:CCGGCTCCTACGACAAACGGATCATCTCGAGATGATCCGTTTGTCGTAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)