EMAIL THIS PAGE TO A FRIEND

LSG1

large 60S subunit nuclear export GTPase 1

51 Gene Product Result for
UniProtKB ID: Q9H089, A0JLT4, A0PJK3, A6NI18, Q7L9H8, Q9NUK8
Gene ID:
Human(55341) Summary: This gene encodes a protein related to the yeast large subunit GTPase 1. The encoded protein is necessary for cell viability and may localize in the endoplasmic reticulum, nucleus and cytoplasm.[provided by RefSeq, Feb 2009]
Mouse(224092) large subunit GTPase 1 homolog (S. cerevisiae)
Rat(288029) large subunit GTPase 1 homolog (S. cerevisiae)
Zebrafish(323464) large subunit GTPase 1 homolog (S. cerevisiae)
Horse(100069172) large subunit GTPase 1 homolog (S. cerevisiae)
cow(505082) large subunit GTPase 1 homolog (S. cerevisiae)
domestic cat(101086415) large subunit GTPase 1 homolog (S. cerevisiae)
dog(478606) large subunit GTPase 1 homolog (S. cerevisiae)
chicken(424897) large subunit GTPase 1 homolog (S. cerevisiae)
sheep(101105791) large subunit GTPase 1 homolog (S. cerevisiae)
domestic guinea pig(100719073) large subunit GTPase 1 homolog (S. cerevisiae)
naked mole-rat(101726054) large subunit GTPase 1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178069 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178069 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178069 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018385 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018385 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018385 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018385 Rosetta Predictions human pricing
NM_001013421 Rosetta Predictions rat pricing
NM_178069 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351874 predicted 1410
2 SASI_Hs01_00134529 predicted 1531
3 SASI_Hs01_00134530 predicted 529
4 SASI_Hs01_00134531 predicted 1117
5 SASI_Hs01_00134532 predicted 805
6 SASI_Hs01_00134533 predicted 576
7 SASI_Hs01_00134534 predicted 472
8 SASI_Hs02_00351875 predicted 1429
9 SASI_Hs01_00134535 predicted 1394
10 SASI_Hs01_00134537 predicted 1373
11 SASI_Hs01_00134536 predicted 797
12 SASI_Hs01_00134538 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013421 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085447 predicted 719
2 SASI_Rn01_00085448 predicted 1525
3 SASI_Rn02_00201089 predicted 529
4 SASI_Rn01_00085449 predicted 759
5 SASI_Rn01_00085450 predicted 582
6 SASI_Rn01_00085452 predicted 272
7 SASI_Rn02_00201090 predicted 1351
8 SASI_Rn01_00085454 predicted 1795
9 SASI_Rn01_00085455 predicted 1375
10 SASI_Rn01_00085456 predicted 574
11 SASI_Rn01_00085451 predicted 1420
12 SASI_Rn01_00085453 predicted 824
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178069 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049016 predicted 566
2 SASI_Mm01_00049017 predicted 751
3 SASI_Mm01_00049018 predicted 689
4 SASI_Mm01_00049019 predicted 1416
5 SASI_Mm01_00049020 predicted 938
6 SASI_Mm01_00049021 predicted 223
7 SASI_Mm01_00049022 predicted 308
8 SASI_Mm01_00049023 predicted 1110
9 SASI_Mm01_00049024 predicted 1362
10 SASI_Mm01_00049025 predicted 605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178069
VALIDATED
LSG1 MISSION shRNA Bacterial Glycerol Stock
large 60S subunit nuclear export GTPase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178069.2-1608s1c1
Sequence:CCGGCGGTACATCCTAAAGGACTATCTCGAGATAGTCCTTTAGGATGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178069.2-865s1c1
Sequence:CCGGCCAGTTTGGATGCGAATGAAACTCGAGTTTCATTCGCATCCAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178069.2-398s1c1
Sequence:CCGGGAGGCCAAATTGGGACAGAAACTCGAGTTTCTGTCCCAATTTGGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178069.2-861s1c1
Sequence:CCGGAGCTCCAGTTTGGATGCGAATCTCGAGATTCGCATCCAAACTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178069.5-861s21c1
Sequence:CCGGAGCTCCAGTTTGGATGCGAATCTCGAGATTCGCATCCAAACTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178069.5-780s21c1
Sequence:CCGGGCAGAAACTGATCACCTAAATCTCGAGATTTAGGTGATCAGTTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178069.5-1608s21c1
Sequence:CCGGCGGTACATCCTAAAGGACTATCTCGAGATAGTCCTTTAGGATGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178069.5-398s21c1
Sequence:CCGGGAGGCCAAATTGGGACAGAAACTCGAGTTTCTGTCCCAATTTGGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178069
VALIDATED
LSG1 MISSION shRNA shRNA Plasmid DNA
large 60S subunit nuclear export GTPase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178069.2-1608s1c1
Sequence:CCGGCGGTACATCCTAAAGGACTATCTCGAGATAGTCCTTTAGGATGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178069.2-865s1c1
Sequence:CCGGCCAGTTTGGATGCGAATGAAACTCGAGTTTCATTCGCATCCAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178069.2-398s1c1
Sequence:CCGGGAGGCCAAATTGGGACAGAAACTCGAGTTTCTGTCCCAATTTGGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178069.2-861s1c1
Sequence:CCGGAGCTCCAGTTTGGATGCGAATCTCGAGATTCGCATCCAAACTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178069.5-861s21c1
Sequence:CCGGAGCTCCAGTTTGGATGCGAATCTCGAGATTCGCATCCAAACTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178069.5-780s21c1
Sequence:CCGGGCAGAAACTGATCACCTAAATCTCGAGATTTAGGTGATCAGTTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178069.5-1608s21c1
Sequence:CCGGCGGTACATCCTAAAGGACTATCTCGAGATAGTCCTTTAGGATGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178069.5-398s21c1
Sequence:CCGGGAGGCCAAATTGGGACAGAAACTCGAGTTTCTGTCCCAATTTGGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178069
VALIDATED
LSG1 MISSION shRNA Lentiviral Transduction Particles
large 60S subunit nuclear export GTPase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178069.2-1608s1c1
Sequence:CCGGCGGTACATCCTAAAGGACTATCTCGAGATAGTCCTTTAGGATGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178069.2-865s1c1
Sequence:CCGGCCAGTTTGGATGCGAATGAAACTCGAGTTTCATTCGCATCCAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178069.2-398s1c1
Sequence:CCGGGAGGCCAAATTGGGACAGAAACTCGAGTTTCTGTCCCAATTTGGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178069.2-861s1c1
Sequence:CCGGAGCTCCAGTTTGGATGCGAATCTCGAGATTCGCATCCAAACTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178069.5-861s21c1
Sequence:CCGGAGCTCCAGTTTGGATGCGAATCTCGAGATTCGCATCCAAACTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178069.5-780s21c1
Sequence:CCGGGCAGAAACTGATCACCTAAATCTCGAGATTTAGGTGATCAGTTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178069.5-1608s21c1
Sequence:CCGGCGGTACATCCTAAAGGACTATCTCGAGATAGTCCTTTAGGATGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178069.5-398s21c1
Sequence:CCGGGAGGCCAAATTGGGACAGAAACTCGAGTTTCTGTCCCAATTTGGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018385
VALIDATED
LSG1 MISSION shRNA Bacterial Glycerol Stock
large 60S subunit nuclear export GTPase 1
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018385.1-882s1c1
Sequence:CCGGGCTAGGGATTCTCCTTCACTTCTCGAGAAGTGAAGGAGAATCCCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018385.1-554s1c1
Sequence:CCGGCCAGATAGTAGATGCTCGAAACTCGAGTTTCGAGCATCTACTATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018385.1-1414s1c1
Sequence:CCGGGAGATCATGTTCCTCCTGTATCTCGAGATACAGGAGGAACATGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018385.1-132s1c1
Sequence:CCGGGAACTCAATGATGGCTATGATCTCGAGATCATAGCCATCATTGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018385.1-411s1c1
Sequence:CCGGGCAGAGAAAGATAACTTTCTACTCGAGTAGAAAGTTATCTTTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018385.1-1477s1c1
Sequence:CCGGCCTATGGCATTAACATCATAACTCGAGTTATGATGTTAATGCCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018385.1-627s1c1
Sequence:CCGGGCCAATAAGGAGAACGTCATTCTCGAGAATGACGTTCTCCTTATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018385.1-579s1c1
Sequence:CCGGCTCCTGTTTAGATGTGAGGATCTCGAGATCCTCACATCTAAACAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018385.2-2532s21c1
Sequence:CCGGCACGCACCAACATGGAGAAACCTCGAGGTTTCTCCATGTTGGTGCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018385.2-1130s21c1
Sequence:CCGGGTTTCGACCAGGCTGAAATTTCTCGAGAAATTTCAGCCTGGTCGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018385.2-1417s21c1
Sequence:CCGGGAGTTACTGGAGCTCTTTAAGCTCGAGCTTAAAGAGCTCCAGTAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018385.2-2749s21c1
Sequence:CCGGGATGGTTCACGAGACACATTTCTCGAGAAATGTGTCTCGTGAACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018385.1-2655s1c1
Sequence:CCGGCACTGGTTATTCCACTTATTTCTCGAGAAATAAGTGGAATAACCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018385.1-2616s1c1
Sequence:CCGGACAGGGAAGCTGCGGTATTTACTCGAGTAAATACCGCAGCTTCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018385.2-822s21c1
Sequence:CCGGAGTCATTGAGAGAAGTGATATCTCGAGATATCACTTCTCTCAATGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018385.2-2486s21c1
Sequence:CCGGTCATCTGGGAGCCCGAGAATCCTCGAGGATTCTCGGGCTCCCAGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018385.2-1458s21c1
Sequence:CCGGGGTGAAAGATGGGCAACTTACCTCGAGGTAAGTTGCCCATCTTTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018385
VALIDATED
LSG1 MISSION shRNA shRNA Plasmid DNA
large 60S subunit nuclear export GTPase 1
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018385.1-882s1c1
Sequence:CCGGGCTAGGGATTCTCCTTCACTTCTCGAGAAGTGAAGGAGAATCCCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018385.1-554s1c1
Sequence:CCGGCCAGATAGTAGATGCTCGAAACTCGAGTTTCGAGCATCTACTATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018385.1-1414s1c1
Sequence:CCGGGAGATCATGTTCCTCCTGTATCTCGAGATACAGGAGGAACATGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018385.1-132s1c1
Sequence:CCGGGAACTCAATGATGGCTATGATCTCGAGATCATAGCCATCATTGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018385.1-411s1c1
Sequence:CCGGGCAGAGAAAGATAACTTTCTACTCGAGTAGAAAGTTATCTTTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018385.1-1477s1c1
Sequence:CCGGCCTATGGCATTAACATCATAACTCGAGTTATGATGTTAATGCCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018385.1-627s1c1
Sequence:CCGGGCCAATAAGGAGAACGTCATTCTCGAGAATGACGTTCTCCTTATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018385.1-579s1c1
Sequence:CCGGCTCCTGTTTAGATGTGAGGATCTCGAGATCCTCACATCTAAACAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018385.2-2532s21c1
Sequence:CCGGCACGCACCAACATGGAGAAACCTCGAGGTTTCTCCATGTTGGTGCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018385.2-1130s21c1
Sequence:CCGGGTTTCGACCAGGCTGAAATTTCTCGAGAAATTTCAGCCTGGTCGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018385.2-1417s21c1
Sequence:CCGGGAGTTACTGGAGCTCTTTAAGCTCGAGCTTAAAGAGCTCCAGTAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018385.2-2749s21c1
Sequence:CCGGGATGGTTCACGAGACACATTTCTCGAGAAATGTGTCTCGTGAACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018385.1-2655s1c1
Sequence:CCGGCACTGGTTATTCCACTTATTTCTCGAGAAATAAGTGGAATAACCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018385.1-2616s1c1
Sequence:CCGGACAGGGAAGCTGCGGTATTTACTCGAGTAAATACCGCAGCTTCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018385.2-822s21c1
Sequence:CCGGAGTCATTGAGAGAAGTGATATCTCGAGATATCACTTCTCTCAATGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018385.2-2486s21c1
Sequence:CCGGTCATCTGGGAGCCCGAGAATCCTCGAGGATTCTCGGGCTCCCAGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018385.2-1458s21c1
Sequence:CCGGGGTGAAAGATGGGCAACTTACCTCGAGGTAAGTTGCCCATCTTTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018385
VALIDATED
LSG1 MISSION shRNA Lentiviral Transduction Particles
large 60S subunit nuclear export GTPase 1
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018385.1-882s1c1
Sequence:CCGGGCTAGGGATTCTCCTTCACTTCTCGAGAAGTGAAGGAGAATCCCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018385.1-554s1c1
Sequence:CCGGCCAGATAGTAGATGCTCGAAACTCGAGTTTCGAGCATCTACTATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018385.1-1414s1c1
Sequence:CCGGGAGATCATGTTCCTCCTGTATCTCGAGATACAGGAGGAACATGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018385.1-132s1c1
Sequence:CCGGGAACTCAATGATGGCTATGATCTCGAGATCATAGCCATCATTGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018385.1-411s1c1
Sequence:CCGGGCAGAGAAAGATAACTTTCTACTCGAGTAGAAAGTTATCTTTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018385.1-1477s1c1
Sequence:CCGGCCTATGGCATTAACATCATAACTCGAGTTATGATGTTAATGCCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018385.1-627s1c1
Sequence:CCGGGCCAATAAGGAGAACGTCATTCTCGAGAATGACGTTCTCCTTATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018385.1-579s1c1
Sequence:CCGGCTCCTGTTTAGATGTGAGGATCTCGAGATCCTCACATCTAAACAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018385.2-2532s21c1
Sequence:CCGGCACGCACCAACATGGAGAAACCTCGAGGTTTCTCCATGTTGGTGCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018385.2-1130s21c1
Sequence:CCGGGTTTCGACCAGGCTGAAATTTCTCGAGAAATTTCAGCCTGGTCGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018385.2-1417s21c1
Sequence:CCGGGAGTTACTGGAGCTCTTTAAGCTCGAGCTTAAAGAGCTCCAGTAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018385.2-2749s21c1
Sequence:CCGGGATGGTTCACGAGACACATTTCTCGAGAAATGTGTCTCGTGAACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018385.1-2655s1c1
Sequence:CCGGCACTGGTTATTCCACTTATTTCTCGAGAAATAAGTGGAATAACCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018385.1-2616s1c1
Sequence:CCGGACAGGGAAGCTGCGGTATTTACTCGAGTAAATACCGCAGCTTCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018385.2-822s21c1
Sequence:CCGGAGTCATTGAGAGAAGTGATATCTCGAGATATCACTTCTCTCAATGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018385.2-2486s21c1
Sequence:CCGGTCATCTGGGAGCCCGAGAATCCTCGAGGATTCTCGGGCTCCCAGATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018385.2-1458s21c1
Sequence:CCGGGGTGAAAGATGGGCAACTTACCTCGAGGTAAGTTGCCCATCTTTCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)