EMAIL THIS PAGE TO A FRIEND

LSM11

LSM11, U7 small nuclear RNA associated

124 Gene Product Result for
UniProtKB ID: P83369, A0AVQ1, Q7Z7P0, Q8N975
Gene ID:
Mouse(72290) U7 snRNP-specific Sm-like protein LSM11
Rat(501688) LSM11, U7 small nuclear RNA associated
Zebrafish(100004030) LSM11, U7 small nuclear RNA associated
fruit fly(36013) CG12924 gene product from transcript CG12924-RA
cow(785718) LSM11, U7 small nuclear RNA associated
domestic cat(101091253) LSM11, U7 small nuclear RNA associated
dog(479314) LSM11, U7 small nuclear RNA associated
chicken(416241) LSM11, U7 small nuclear RNA associated
sheep(101114109) LSM11, U7 small nuclear RNA associated
naked mole-rat(101705581) LSM11, U7 small nuclear RNA associated
domestic guinea pig(100731759) LSM11, U7 small nuclear RNA associated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173491 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173491 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173491 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028185 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028185 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028185 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173491 Rosetta Predictions human pricing
XM_001068848 Rosetta Predictions rat pricing
XM_577085 Rosetta Predictions rat pricing
NM_028185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060284 predicted 1156
2 SASI_Hs01_00060285 predicted 1123
3 SASI_Hs01_00060286 predicted 1003
4 SASI_Hs01_00060287 predicted 568
5 SASI_Hs01_00060288 predicted 735
6 SASI_Hs01_00060289 predicted 568
7 SASI_Hs01_00060290 predicted 1048
8 SASI_Hs01_00060291 predicted 1134
9 SASI_Hs01_00060292 predicted 634
10 SASI_Hs01_00060293 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068848 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326114 predicted 1333
2 SASI_Rn02_00326115 predicted 1469
3 SASI_Rn02_00326116 predicted 810
4 SASI_Rn02_00326117 predicted 1329
5 SASI_Rn02_00326118 predicted 885
6 SASI_Rn02_00326119 predicted 818
7 SASI_Rn02_00326120 predicted 1213
8 SASI_Rn02_00326121 predicted 941
9 SASI_Rn02_00326122 predicted 1356
10 SASI_Rn02_00326123 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406144 predicted 441
2 SASI_Rn02_00406145 predicted 541
3 SASI_Rn02_00406146 predicted 538
4 SASI_Rn02_00406147 predicted 639
5 SASI_Rn02_00406148 predicted 640
6 SASI_Rn02_00406149 predicted 551
7 SASI_Rn02_00406150 predicted 434
8 SASI_Rn02_00406151 predicted 706
9 SASI_Rn02_00406152 predicted 634
10 SASI_Rn02_00406153 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057461 predicted 637
2 SASI_Mm02_00333467 predicted 1342
3 SASI_Mm02_00333468 predicted 1407
4 SASI_Mm01_00057462 predicted 1123
5 SASI_Mm01_00057463 predicted 1148
6 SASI_Mm02_00333469 predicted 1494
7 SASI_Mm01_00057468 predicted 447
8 SASI_Mm02_00333470 predicted 1445
9 SASI_Mm02_00333471 predicted 1569
10 SASI_Mm02_00333472 predicted 1505
11 SASI_Mm01_00057464 predicted 638
12 SASI_Mm01_00057465 predicted 1156
13 SASI_Mm01_00057466 predicted 1031
14 SASI_Mm01_00057467 predicted 641
15 SASI_Mm01_00057469 predicted 702
16 SASI_Mm01_00057470 predicted 1041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173491
VALIDATED
LSM11 MISSION shRNA Bacterial Glycerol Stock
LSM11, U7 small nuclear RNA associated
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173491.2-1388s21c1
Sequence:CCGGCATGATATGAGTGGAATTTACCTCGAGGTAAATTCCACTCATATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173491.2-988s21c1
Sequence:CCGGGCGAAAGCCCAAAGTGGATTACTCGAGTAATCCACTTTGGGCTTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173491.2-1137s21c1
Sequence:CCGGGCTATGCTGTATCCTAGTATCCTCGAGGATACTAGGATACAGCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173491.2-743s21c1
Sequence:CCGGGATTCCACTCTGTCTAGATACCTCGAGGTATCTAGACAGAGTGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173491.1-2180s1c1
Sequence:CCGGCCACAAATACTTCTACTTGAACTCGAGTTCAAGTAGAAGTATTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173491.1-1014s1c1
Sequence:CCGGGCAGGTATTCACTCGACACATCTCGAGATGTGTCGAGTGAATACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173491.1-721s1c1
Sequence:CCGGGCAGATTCTAAGTCTGCAGTTCTCGAGAACTGCAGACTTAGAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173491.1-638s1c1
Sequence:CCGGGCAAAGCATATGAACGGGATTCTCGAGAATCCCGTTCATATGCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173491.1-571s1c1
Sequence:CCGGGCATTCGACAAGTTCTGGAATCTCGAGATTCCAGAACTTGTCGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173491
VALIDATED
LSM11 MISSION shRNA shRNA Plasmid DNA
LSM11, U7 small nuclear RNA associated
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173491.2-1388s21c1
Sequence:CCGGCATGATATGAGTGGAATTTACCTCGAGGTAAATTCCACTCATATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173491.2-988s21c1
Sequence:CCGGGCGAAAGCCCAAAGTGGATTACTCGAGTAATCCACTTTGGGCTTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173491.2-1137s21c1
Sequence:CCGGGCTATGCTGTATCCTAGTATCCTCGAGGATACTAGGATACAGCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173491.2-743s21c1
Sequence:CCGGGATTCCACTCTGTCTAGATACCTCGAGGTATCTAGACAGAGTGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173491.1-2180s1c1
Sequence:CCGGCCACAAATACTTCTACTTGAACTCGAGTTCAAGTAGAAGTATTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173491.1-1014s1c1
Sequence:CCGGGCAGGTATTCACTCGACACATCTCGAGATGTGTCGAGTGAATACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173491.1-721s1c1
Sequence:CCGGGCAGATTCTAAGTCTGCAGTTCTCGAGAACTGCAGACTTAGAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173491.1-638s1c1
Sequence:CCGGGCAAAGCATATGAACGGGATTCTCGAGAATCCCGTTCATATGCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173491.1-571s1c1
Sequence:CCGGGCATTCGACAAGTTCTGGAATCTCGAGATTCCAGAACTTGTCGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173491
VALIDATED
LSM11 MISSION shRNA Lentiviral Transduction Particles
LSM11, U7 small nuclear RNA associated
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173491.2-1388s21c1
Sequence:CCGGCATGATATGAGTGGAATTTACCTCGAGGTAAATTCCACTCATATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173491.2-988s21c1
Sequence:CCGGGCGAAAGCCCAAAGTGGATTACTCGAGTAATCCACTTTGGGCTTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173491.2-1137s21c1
Sequence:CCGGGCTATGCTGTATCCTAGTATCCTCGAGGATACTAGGATACAGCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173491.2-743s21c1
Sequence:CCGGGATTCCACTCTGTCTAGATACCTCGAGGTATCTAGACAGAGTGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173491.1-2180s1c1
Sequence:CCGGCCACAAATACTTCTACTTGAACTCGAGTTCAAGTAGAAGTATTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173491.1-1014s1c1
Sequence:CCGGGCAGGTATTCACTCGACACATCTCGAGATGTGTCGAGTGAATACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173491.1-721s1c1
Sequence:CCGGGCAGATTCTAAGTCTGCAGTTCTCGAGAACTGCAGACTTAGAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173491.1-638s1c1
Sequence:CCGGGCAAAGCATATGAACGGGATTCTCGAGAATCCCGTTCATATGCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173491.1-571s1c1
Sequence:CCGGGCATTCGACAAGTTCTGGAATCTCGAGATTCCAGAACTTGTCGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028185
LSM11 MISSION shRNA Bacterial Glycerol Stock
LSM11, U7 small nuclear RNA associated
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028185.1-1607s1c1
Sequence:CCGGCGGAGCTTGAAGCTCTTTGATCTCGAGATCAAAGAGCTTCAAGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028185.1-592s1c1
Sequence:CCGGGCCTTCGACAAGTTCTGGAATCTCGAGATTCCAGAACTTGTCGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028185.1-1046s1c1
Sequence:CCGGCTCGGCACATAAATCAGATTTCTCGAGAAATCTGATTTATGTGCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028185.1-594s1c1
Sequence:CCGGCTTCGACAAGTTCTGGAATATCTCGAGATATTCCAGAACTTGTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028185.1-742s1c1
Sequence:CCGGGCGGATTCCAAATCTGCAGTTCTCGAGAACTGCAGATTTGGAATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028185
LSM11 MISSION shRNA shRNA Plasmid DNA
LSM11, U7 small nuclear RNA associated
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028185.1-1607s1c1
Sequence:CCGGCGGAGCTTGAAGCTCTTTGATCTCGAGATCAAAGAGCTTCAAGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028185.1-592s1c1
Sequence:CCGGGCCTTCGACAAGTTCTGGAATCTCGAGATTCCAGAACTTGTCGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028185.1-1046s1c1
Sequence:CCGGCTCGGCACATAAATCAGATTTCTCGAGAAATCTGATTTATGTGCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028185.1-594s1c1
Sequence:CCGGCTTCGACAAGTTCTGGAATATCTCGAGATATTCCAGAACTTGTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028185.1-742s1c1
Sequence:CCGGGCGGATTCCAAATCTGCAGTTCTCGAGAACTGCAGATTTGGAATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028185
LSM11 MISSION shRNA Lentiviral Transduction Particles
LSM11, U7 small nuclear RNA associated
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028185.1-1607s1c1
Sequence:CCGGCGGAGCTTGAAGCTCTTTGATCTCGAGATCAAAGAGCTTCAAGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028185.1-592s1c1
Sequence:CCGGGCCTTCGACAAGTTCTGGAATCTCGAGATTCCAGAACTTGTCGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028185.1-1046s1c1
Sequence:CCGGCTCGGCACATAAATCAGATTTCTCGAGAAATCTGATTTATGTGCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028185.1-594s1c1
Sequence:CCGGCTTCGACAAGTTCTGGAATATCTCGAGATATTCCAGAACTTGTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028185.1-742s1c1
Sequence:CCGGGCGGATTCCAAATCTGCAGTTCTCGAGAACTGCAGATTTGGAATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)