EMAIL THIS PAGE TO A FRIEND

LSM12

LSM12 homolog (S. cerevisiae)

154 Gene Product Result for
Synonyms: PNAS-135
UniProtKB ID: Q3MHD2, Q86YB1, Q96NL5
Gene ID:
Mouse(268490) LSM12 homolog (S. cerevisiae)
Rat(287731) LSM12 homolog (S. cerevisiae)
domestic guinea pig(100723523) LSM12 homolog (S. cerevisiae)
naked mole-rat(101724962) LSM12 homolog (S. cerevisiae)
sheep(101113160) LSM12 homolog (S. cerevisiae)
dog(480504) LSM12 homolog (S. cerevisiae)
domestic cat(101097527) LSM12 homolog (S. cerevisiae)
cow(538005) LSM12 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152344 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152344 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152344 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172947 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172947 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172947 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152344 Rosetta Predictions human pricing
NM_001105843 Rosetta Predictions rat pricing
NM_172947 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177449 predicted 735
2 SASI_Hs01_00177450 predicted 453
3 SASI_Hs01_00177452 predicted 283
4 SASI_Hs01_00177453 predicted 890
5 SASI_Hs01_00177454 predicted 747
6 SASI_Hs01_00177455 predicted 397
7 SASI_Hs01_00177456 predicted 522
8 SASI_Hs02_00365963 predicted 881
9 SASI_Hs01_00177457 predicted 241
10 SASI_Hs01_00177458 predicted 578
11 SASI_Hs01_00177451 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213072 predicted 458
2 SASI_Rn02_00213073 predicted 282
3 SASI_Rn02_00213074 predicted 522
4 SASI_Rn02_00213075 predicted 450
5 SASI_Rn02_00213076 predicted 394
6 SASI_Rn02_00213077 predicted 401
7 SASI_Rn02_00213078 predicted 134
8 SASI_Rn02_00213079 predicted 983
9 SASI_Rn02_00213080 predicted 839
10 SASI_Rn02_00213081 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172947 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086692 predicted 454
2 SASI_Mm01_00086693 predicted 453
3 SASI_Mm01_00086694 predicted 448
4 SASI_Mm01_00086695 predicted 276
5 SASI_Mm01_00086696 predicted 449
6 SASI_Mm01_00086697 predicted 393
7 SASI_Mm01_00086698 predicted 403
8 SASI_Mm01_00086699 predicted 513
9 SASI_Mm01_00086700 predicted 238
10 SASI_Mm01_00086701 predicted 334
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152344
VALIDATED
LSM12 MISSION shRNA Bacterial Glycerol Stock
LSM12 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000133736    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152344.1-943s1c1
Sequence:CCGGCCTTTACTTCTGACTTTCCTTCTCGAGAAGGAAAGTCAGAAGTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152344.3-556s21c1
Sequence:CCGGCCCTAGCTTCACTCAATGTTACTCGAGTAACATTGAGTGAAGCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_152344.3-674s21c1
Sequence:CCGGCCAGACCATTCACAAGACCATCTCGAGATGGTCTTGTGAATGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152344.1-396s1c1
Sequence:CCGGGCTCTTCCAGACCATTCACAACTCGAGTTGTGAATGGTCTGGAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152344.1-1885s1c1
Sequence:CCGGCCAGTTTGTCTGGTTGACTAACTCGAGTTAGTCAACCAGACAAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_152344.1-402s1c1
Sequence:CCGGCCAGACCATTCACAAGACCATCTCGAGATGGTCTTGTGAATGGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138096    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152344.1-1636s1c1
Sequence:CCGGGCTCCTCATTGAGGGATAGTTCTCGAGAACTATCCCTCAATGAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152344.1-284s1c1
Sequence:CCGGCCCTAGCTTCACTCAATGTTACTCGAGTAACATTGAGTGAAGCTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152344.1-232s1c1
Sequence:CCGGCAGTATGTTTCAGAAGTGGAACTCGAGTTCCACTTCTGAAACATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_152344.3-987s21c1
Sequence:CCGGGGGAGGGAAGGGATCCTATATCTCGAGATATAGGATCCCTTCCCTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_152344.3-504s21c1
Sequence:CCGGCAGTATGTTTCAGAAGTGGAACTCGAGTTCCACTTCTGAAACATACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_152344.3-730s21c1
Sequence:CCGGTCATGGAAGAAGTTGTTATTACTCGAGTAATAACAACTTCTTCCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152344
VALIDATED
LSM12 MISSION shRNA shRNA Plasmid DNA
LSM12 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000133736    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152344.1-943s1c1
Sequence:CCGGCCTTTACTTCTGACTTTCCTTCTCGAGAAGGAAAGTCAGAAGTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152344.3-556s21c1
Sequence:CCGGCCCTAGCTTCACTCAATGTTACTCGAGTAACATTGAGTGAAGCTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_152344.3-674s21c1
Sequence:CCGGCCAGACCATTCACAAGACCATCTCGAGATGGTCTTGTGAATGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152344.1-396s1c1
Sequence:CCGGGCTCTTCCAGACCATTCACAACTCGAGTTGTGAATGGTCTGGAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152344.1-1885s1c1
Sequence:CCGGCCAGTTTGTCTGGTTGACTAACTCGAGTTAGTCAACCAGACAAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_152344.1-402s1c1
Sequence:CCGGCCAGACCATTCACAAGACCATCTCGAGATGGTCTTGTGAATGGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138096    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152344.1-1636s1c1
Sequence:CCGGGCTCCTCATTGAGGGATAGTTCTCGAGAACTATCCCTCAATGAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152344.1-284s1c1
Sequence:CCGGCCCTAGCTTCACTCAATGTTACTCGAGTAACATTGAGTGAAGCTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152344.1-232s1c1
Sequence:CCGGCAGTATGTTTCAGAAGTGGAACTCGAGTTCCACTTCTGAAACATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_152344.3-987s21c1
Sequence:CCGGGGGAGGGAAGGGATCCTATATCTCGAGATATAGGATCCCTTCCCTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_152344.3-504s21c1
Sequence:CCGGCAGTATGTTTCAGAAGTGGAACTCGAGTTCCACTTCTGAAACATACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_152344.3-730s21c1
Sequence:CCGGTCATGGAAGAAGTTGTTATTACTCGAGTAATAACAACTTCTTCCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152344
VALIDATED
LSM12 MISSION shRNA Lentiviral Transduction Particles
LSM12 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000133736    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152344.1-943s1c1
Sequence:CCGGCCTTTACTTCTGACTTTCCTTCTCGAGAAGGAAAGTCAGAAGTAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152344.3-556s21c1
Sequence:CCGGCCCTAGCTTCACTCAATGTTACTCGAGTAACATTGAGTGAAGCTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_152344.3-674s21c1
Sequence:CCGGCCAGACCATTCACAAGACCATCTCGAGATGGTCTTGTGAATGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152344.1-396s1c1
Sequence:CCGGGCTCTTCCAGACCATTCACAACTCGAGTTGTGAATGGTCTGGAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152344.1-1885s1c1
Sequence:CCGGCCAGTTTGTCTGGTTGACTAACTCGAGTTAGTCAACCAGACAAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_152344.1-402s1c1
Sequence:CCGGCCAGACCATTCACAAGACCATCTCGAGATGGTCTTGTGAATGGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138096    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152344.1-1636s1c1
Sequence:CCGGGCTCCTCATTGAGGGATAGTTCTCGAGAACTATCCCTCAATGAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152344.1-284s1c1
Sequence:CCGGCCCTAGCTTCACTCAATGTTACTCGAGTAACATTGAGTGAAGCTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152344.1-232s1c1
Sequence:CCGGCAGTATGTTTCAGAAGTGGAACTCGAGTTCCACTTCTGAAACATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_152344.3-987s21c1
Sequence:CCGGGGGAGGGAAGGGATCCTATATCTCGAGATATAGGATCCCTTCCCTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_152344.3-504s21c1
Sequence:CCGGCAGTATGTTTCAGAAGTGGAACTCGAGTTCCACTTCTGAAACATACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_152344.3-730s21c1
Sequence:CCGGTCATGGAAGAAGTTGTTATTACTCGAGTAATAACAACTTCTTCCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172947
VALIDATED
LSM12 MISSION shRNA Bacterial Glycerol Stock
LSM12 homolog (S. cerevisiae)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172947.1-883s1c1
Sequence:CCGGCCTCTGAACAGTCATCTTGTTCTCGAGAACAAGATGACTGTTCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172947.1-458s1c1
Sequence:CCGGGTCATGGAAGAAGTTGTTATTCTCGAGAATAACAACTTCTTCCATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172947.3-1062s21c1
Sequence:CCGGGCTGACTGTGATTCTGATGTTCTCGAGAACATCAGAATCACAGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172947.1-1064s1c1
Sequence:CCGGGCTGACTGTGATTCTGATGTTCTCGAGAACATCAGAATCACAGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172947.3-284s21c1
Sequence:CCGGCCTAGCTTCACTCAATGTTAGCTCGAGCTAACATTGAGTGAAGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172947.3-456s21c1
Sequence:CCGGGTCATGGAAGAAGTTGTTATTCTCGAGAATAACAACTTCTTCCATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172947.1-455s1c1
Sequence:CCGGGTAGTCATGGAAGAAGTTGTTCTCGAGAACAACTTCTTCCATGACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172947.1-415s1c1
Sequence:CCGGCAAGACCATTAAAGACTGTAACTCGAGTTACAGTCTTTAATGGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172947.1-406s1c1
Sequence:CCGGGACCATTCACAAGACCATTAACTCGAGTTAATGGTCTTGTGAATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172947.1-302s1c1
Sequence:CCGGGTTAGTAAGCTTGCCAGCAAACTCGAGTTTGCTGGCAAGCTTACTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172947.1-205s1c1
Sequence:CCGGCCATGCAGACATCTTGCTTATCTCGAGATAAGCAAGATGTCTGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172947.3-203s21c1
Sequence:CCGGCCATGCAGACATCTTGCTTATCTCGAGATAAGCAAGATGTCTGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172947.3-628s21c1
Sequence:CCGGTGTCATCCTGAGTCCACAAACCTCGAGGTTTGTGGACTCAGGATGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172947
VALIDATED
LSM12 MISSION shRNA shRNA Plasmid DNA
LSM12 homolog (S. cerevisiae)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172947.1-883s1c1
Sequence:CCGGCCTCTGAACAGTCATCTTGTTCTCGAGAACAAGATGACTGTTCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172947.1-458s1c1
Sequence:CCGGGTCATGGAAGAAGTTGTTATTCTCGAGAATAACAACTTCTTCCATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172947.3-1062s21c1
Sequence:CCGGGCTGACTGTGATTCTGATGTTCTCGAGAACATCAGAATCACAGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172947.1-1064s1c1
Sequence:CCGGGCTGACTGTGATTCTGATGTTCTCGAGAACATCAGAATCACAGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172947.3-284s21c1
Sequence:CCGGCCTAGCTTCACTCAATGTTAGCTCGAGCTAACATTGAGTGAAGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172947.3-456s21c1
Sequence:CCGGGTCATGGAAGAAGTTGTTATTCTCGAGAATAACAACTTCTTCCATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172947.1-455s1c1
Sequence:CCGGGTAGTCATGGAAGAAGTTGTTCTCGAGAACAACTTCTTCCATGACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172947.1-415s1c1
Sequence:CCGGCAAGACCATTAAAGACTGTAACTCGAGTTACAGTCTTTAATGGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172947.1-406s1c1
Sequence:CCGGGACCATTCACAAGACCATTAACTCGAGTTAATGGTCTTGTGAATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172947.1-302s1c1
Sequence:CCGGGTTAGTAAGCTTGCCAGCAAACTCGAGTTTGCTGGCAAGCTTACTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172947.1-205s1c1
Sequence:CCGGCCATGCAGACATCTTGCTTATCTCGAGATAAGCAAGATGTCTGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172947.3-203s21c1
Sequence:CCGGCCATGCAGACATCTTGCTTATCTCGAGATAAGCAAGATGTCTGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172947.3-628s21c1
Sequence:CCGGTGTCATCCTGAGTCCACAAACCTCGAGGTTTGTGGACTCAGGATGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172947
VALIDATED
LSM12 MISSION shRNA Lentiviral Transduction Particles
LSM12 homolog (S. cerevisiae)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172947.1-883s1c1
Sequence:CCGGCCTCTGAACAGTCATCTTGTTCTCGAGAACAAGATGACTGTTCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172947.1-458s1c1
Sequence:CCGGGTCATGGAAGAAGTTGTTATTCTCGAGAATAACAACTTCTTCCATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172947.3-1062s21c1
Sequence:CCGGGCTGACTGTGATTCTGATGTTCTCGAGAACATCAGAATCACAGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172947.1-1064s1c1
Sequence:CCGGGCTGACTGTGATTCTGATGTTCTCGAGAACATCAGAATCACAGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172947.3-284s21c1
Sequence:CCGGCCTAGCTTCACTCAATGTTAGCTCGAGCTAACATTGAGTGAAGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172947.3-456s21c1
Sequence:CCGGGTCATGGAAGAAGTTGTTATTCTCGAGAATAACAACTTCTTCCATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172947.1-455s1c1
Sequence:CCGGGTAGTCATGGAAGAAGTTGTTCTCGAGAACAACTTCTTCCATGACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172947.1-415s1c1
Sequence:CCGGCAAGACCATTAAAGACTGTAACTCGAGTTACAGTCTTTAATGGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172947.1-406s1c1
Sequence:CCGGGACCATTCACAAGACCATTAACTCGAGTTAATGGTCTTGTGAATGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172947.1-302s1c1
Sequence:CCGGGTTAGTAAGCTTGCCAGCAAACTCGAGTTTGCTGGCAAGCTTACTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172947.1-205s1c1
Sequence:CCGGCCATGCAGACATCTTGCTTATCTCGAGATAAGCAAGATGTCTGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172947.3-203s21c1
Sequence:CCGGCCATGCAGACATCTTGCTTATCTCGAGATAAGCAAGATGTCTGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172947.3-628s21c1
Sequence:CCGGTGTCATCCTGAGTCCACAAACCTCGAGGTTTGTGGACTCAGGATGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)