EMAIL THIS PAGE TO A FRIEND

LSM14A

LSM14A, SCD6 homolog A (S. cerevisiae)

165 Gene Product Result for
Synonyms: C19orf13 FAM61A RAP55 RAP55A
UniProtKB ID: Q8ND56, Q76LX7, Q96AR3, Q96K73, Q96SN5, Q9UFR3
Gene ID:
Human(26065) Summary: Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing.[supplied by OMIM, Mar 2008]
Mouse(67070) LSM14 homolog A (SCD6, S. cerevisiae)
Rat(361554) LSM14A, SCD6 homolog A (S. cerevisiae)
chicken(415781) LSM14A, SCD6 homolog A (S. cerevisiae)
domestic cat(101082612) LSM14A, SCD6 homolog A (S. cerevisiae)
cow(538838) LSM14A, SCD6 homolog A (S. cerevisiae)
dog(476492) LSM14A, SCD6 homolog A (S. cerevisiae)
sheep(101111736) LSM14A, SCD6 homolog A (S. cerevisiae)
naked mole-rat(101723527) LSM14A, SCD6 homolog A (S. cerevisiae)
domestic guinea pig(100721142) LSM14A, SCD6 homolog A (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025948 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025948 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025948 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015578 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015578 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015578 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114093 Rosetta Predictions human pricing
NM_015578 Rosetta Predictions human pricing
NM_001127552 Rosetta Predictions rat pricing
NM_025948 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326194 predicted 721
2 SASI_Hs02_00326195 predicted 340
3 SASI_Hs02_00326196 predicted 798
4 SASI_Hs02_00326197 predicted 374
5 SASI_Hs02_00326198 predicted 1224
6 SASI_Hs02_00326199 predicted 942
7 SASI_Hs02_00326200 predicted 639
8 SASI_Hs02_00326201 predicted 373
9 SASI_Hs02_00326202 predicted 405
10 SASI_Hs02_00326203 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116381 predicted 714
2 SASI_Hs01_00116382 predicted 339
3 SASI_Hs01_00116384 predicted 804
4 SASI_Hs01_00116385 predicted 376
5 SASI_Hs01_00116386 predicted 1232
6 SASI_Hs01_00116388 predicted 937
7 SASI_Hs02_00348165 predicted 643
8 SASI_Hs02_00348166 predicted 369
9 SASI_Hs02_00348167 predicted 402
10 SASI_Hs02_00348168 predicted 564
11 SASI_Hs01_00116380 predicted 826
12 SASI_Hs01_00116383 predicted 1241
13 SASI_Hs01_00116387 predicted 1054
14 SASI_Hs01_00116389 predicted 1231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127552 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254273 predicted 1082
2 SASI_Rn02_00254274 predicted 965
3 SASI_Rn02_00254275 predicted 1270
4 SASI_Rn02_00254276 predicted 330
5 SASI_Rn02_00254277 predicted 1479
6 SASI_Rn02_00254278 predicted 713
7 SASI_Rn02_00254279 predicted 304
8 SASI_Rn02_00254280 predicted 1029
9 SASI_Rn02_00254281 predicted 461
10 SASI_Rn02_00254282 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123713 predicted 919
2 SASI_Mm01_00123714 predicted 559
3 SASI_Mm01_00123715 predicted 994
4 SASI_Mm01_00123716 predicted 1401
5 SASI_Mm01_00123717 predicted 1138
6 SASI_Mm01_00123718 predicted 832
7 SASI_Mm01_00123719 predicted 304
8 SASI_Mm01_00123720 predicted 1462
9 SASI_Mm01_00123721 predicted 1474
10 SASI_Mm02_00329344 predicted 1396
11 SASI_Mm01_00123712 predicted 1041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025948
VALIDATED
LSM14A MISSION shRNA Bacterial Glycerol Stock
LSM14A, SCD6 homolog A (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025948.2-426s1c1
Sequence:CCGGCAGTTCAGTCCAAGTACATTACTCGAGTAATGTACTTGGACTGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025948.1-966s1c1
Sequence:CCGGGCACAATTTAACAAGGAGGAACTCGAGTTCCTCCTTGTTAAATTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025948.1-336s1c1
Sequence:CCGGGCTATTGTTCAGTCTTCACTACTCGAGTAGTGAAGACTGAACAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025948.1-1764s1c1
Sequence:CCGGCCAGCTAAATGGAACTGCTAACTCGAGTTAGCAGTTCCATTTAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025948.1-178s1c1
Sequence:CCGGCCAAAGTTCGATCCTTCGGTACTCGAGTACCGAAGGATCGAACTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025948.1-206s1c1
Sequence:CCGGCAGACCAACAGATCGTCCAATCTCGAGATTGGACGATCTGTTGGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025948.1-613s1c1
Sequence:CCGGCTCAGTTAGACCCTTTGAGAACTCGAGTTCTCAAAGGGTCTAACTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025948.1-1763s1c1
Sequence:CCGGGCCAGCTAAATGGAACTGCTACTCGAGTAGCAGTTCCATTTAGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025948.1-1410s1c1
Sequence:CCGGGCAGACTTTGAATATAGGAAACTCGAGTTTCCTATATTCAAAGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025948.2-1172s1c1
Sequence:CCGGCAACATCTCTTGTGATGATAACTCGAGTTATCATCACAAGAGATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025948
VALIDATED
LSM14A MISSION shRNA shRNA Plasmid DNA
LSM14A, SCD6 homolog A (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025948.2-426s1c1
Sequence:CCGGCAGTTCAGTCCAAGTACATTACTCGAGTAATGTACTTGGACTGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025948.1-966s1c1
Sequence:CCGGGCACAATTTAACAAGGAGGAACTCGAGTTCCTCCTTGTTAAATTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025948.1-336s1c1
Sequence:CCGGGCTATTGTTCAGTCTTCACTACTCGAGTAGTGAAGACTGAACAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025948.1-1764s1c1
Sequence:CCGGCCAGCTAAATGGAACTGCTAACTCGAGTTAGCAGTTCCATTTAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025948.1-178s1c1
Sequence:CCGGCCAAAGTTCGATCCTTCGGTACTCGAGTACCGAAGGATCGAACTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025948.1-206s1c1
Sequence:CCGGCAGACCAACAGATCGTCCAATCTCGAGATTGGACGATCTGTTGGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025948.1-613s1c1
Sequence:CCGGCTCAGTTAGACCCTTTGAGAACTCGAGTTCTCAAAGGGTCTAACTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025948.1-1763s1c1
Sequence:CCGGGCCAGCTAAATGGAACTGCTACTCGAGTAGCAGTTCCATTTAGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025948.1-1410s1c1
Sequence:CCGGGCAGACTTTGAATATAGGAAACTCGAGTTTCCTATATTCAAAGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025948.2-1172s1c1
Sequence:CCGGCAACATCTCTTGTGATGATAACTCGAGTTATCATCACAAGAGATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025948
VALIDATED
LSM14A MISSION shRNA Lentiviral Transduction Particles
LSM14A, SCD6 homolog A (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025948.2-426s1c1
Sequence:CCGGCAGTTCAGTCCAAGTACATTACTCGAGTAATGTACTTGGACTGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025948.1-966s1c1
Sequence:CCGGGCACAATTTAACAAGGAGGAACTCGAGTTCCTCCTTGTTAAATTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025948.1-336s1c1
Sequence:CCGGGCTATTGTTCAGTCTTCACTACTCGAGTAGTGAAGACTGAACAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025948.1-1764s1c1
Sequence:CCGGCCAGCTAAATGGAACTGCTAACTCGAGTTAGCAGTTCCATTTAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025948.1-178s1c1
Sequence:CCGGCCAAAGTTCGATCCTTCGGTACTCGAGTACCGAAGGATCGAACTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025948.1-206s1c1
Sequence:CCGGCAGACCAACAGATCGTCCAATCTCGAGATTGGACGATCTGTTGGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025948.1-613s1c1
Sequence:CCGGCTCAGTTAGACCCTTTGAGAACTCGAGTTCTCAAAGGGTCTAACTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025948.1-1763s1c1
Sequence:CCGGGCCAGCTAAATGGAACTGCTACTCGAGTAGCAGTTCCATTTAGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025948.1-1410s1c1
Sequence:CCGGGCAGACTTTGAATATAGGAAACTCGAGTTTCCTATATTCAAAGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025948.2-1172s1c1
Sequence:CCGGCAACATCTCTTGTGATGATAACTCGAGTTATCATCACAAGAGATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015578
VALIDATED
LSM14A MISSION shRNA Bacterial Glycerol Stock
LSM14A, SCD6 homolog A (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000146514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015578.1-189s1c1
Sequence:CCGGCTTGCCAAAGTTCGATCCTTTCTCGAGAAAGGATCGAACTTTGGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015578.1-801s1c1
Sequence:CCGGCACAAAGTTTCAAGGCCAGAACTCGAGTTCTGGCCTTGAAACTTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146737    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015578.1-1952s1c1
Sequence:CCGGCCTGTAATATGAGGTAGCTTACTCGAGTAAGCTACCTCATATTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015578.1-571s1c1
Sequence:CCGGCCTTTACACAGGATACAAGATCTCGAGATCTTGTATCCTGTGTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015578.2-342s1c1
Sequence:CCGGGACCGACAGATCGTCCAATACCTCGAGGTATTGGACGATCTGTCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015578.2-395s1c1
Sequence:CCGGTTCCGTGGGAGTGACATTAAACTCGAGTTTAATGTCACTCCCACGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015578.1-2541s1c1
Sequence:CCGGGCCTGGAATTTAGTCATGATACTCGAGTATCATGACTAAATTCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015578.1-1128s1c1
Sequence:CCGGGCCGATGAAGAAGATCCACTTCTCGAGAAGTGGATCTTCTTCATCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015578.1-1067s1c1
Sequence:CCGGGCCTGTAAATGGTGAAGATAACTCGAGTTATCTTCACCATTTACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015578.1-193s1c1
Sequence:CCGGCCAAAGTTCGATCCTTTGGTACTCGAGTACCAAAGGATCGAACTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015578
VALIDATED
LSM14A MISSION shRNA shRNA Plasmid DNA
LSM14A, SCD6 homolog A (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000146514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015578.1-189s1c1
Sequence:CCGGCTTGCCAAAGTTCGATCCTTTCTCGAGAAAGGATCGAACTTTGGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015578.1-801s1c1
Sequence:CCGGCACAAAGTTTCAAGGCCAGAACTCGAGTTCTGGCCTTGAAACTTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146737    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015578.1-1952s1c1
Sequence:CCGGCCTGTAATATGAGGTAGCTTACTCGAGTAAGCTACCTCATATTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015578.1-571s1c1
Sequence:CCGGCCTTTACACAGGATACAAGATCTCGAGATCTTGTATCCTGTGTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015578.2-342s1c1
Sequence:CCGGGACCGACAGATCGTCCAATACCTCGAGGTATTGGACGATCTGTCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015578.2-395s1c1
Sequence:CCGGTTCCGTGGGAGTGACATTAAACTCGAGTTTAATGTCACTCCCACGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015578.1-2541s1c1
Sequence:CCGGGCCTGGAATTTAGTCATGATACTCGAGTATCATGACTAAATTCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015578.1-1128s1c1
Sequence:CCGGGCCGATGAAGAAGATCCACTTCTCGAGAAGTGGATCTTCTTCATCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015578.1-1067s1c1
Sequence:CCGGGCCTGTAAATGGTGAAGATAACTCGAGTTATCTTCACCATTTACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015578.1-193s1c1
Sequence:CCGGCCAAAGTTCGATCCTTTGGTACTCGAGTACCAAAGGATCGAACTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015578
VALIDATED
LSM14A MISSION shRNA Lentiviral Transduction Particles
LSM14A, SCD6 homolog A (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000146514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015578.1-189s1c1
Sequence:CCGGCTTGCCAAAGTTCGATCCTTTCTCGAGAAAGGATCGAACTTTGGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015578.1-801s1c1
Sequence:CCGGCACAAAGTTTCAAGGCCAGAACTCGAGTTCTGGCCTTGAAACTTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146737    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015578.1-1952s1c1
Sequence:CCGGCCTGTAATATGAGGTAGCTTACTCGAGTAAGCTACCTCATATTACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015578.1-571s1c1
Sequence:CCGGCCTTTACACAGGATACAAGATCTCGAGATCTTGTATCCTGTGTAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015578.2-342s1c1
Sequence:CCGGGACCGACAGATCGTCCAATACCTCGAGGTATTGGACGATCTGTCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015578.2-395s1c1
Sequence:CCGGTTCCGTGGGAGTGACATTAAACTCGAGTTTAATGTCACTCCCACGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015578.1-2541s1c1
Sequence:CCGGGCCTGGAATTTAGTCATGATACTCGAGTATCATGACTAAATTCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015578.1-1128s1c1
Sequence:CCGGGCCGATGAAGAAGATCCACTTCTCGAGAAGTGGATCTTCTTCATCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015578.1-1067s1c1
Sequence:CCGGGCCTGTAAATGGTGAAGATAACTCGAGTTATCTTCACCATTTACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015578.1-193s1c1
Sequence:CCGGCCAAAGTTCGATCCTTTGGTACTCGAGTACCAAAGGATCGAACTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)