EMAIL THIS PAGE TO A FRIEND

LSM14B

LSM14B, SCD6 homolog B (S. cerevisiae)

56 Gene Product Result for
Synonyms: C20orf40 FAM61B LSM13 RAP55B bA11M20.3
UniProtKB ID: Q9BX40, Q6PFW8, Q96LH8
Gene ID:
Mouse(241846) LSM14 homolog B (SCD6, S. cerevisiae)
Rat(100362102) LSM14B, SCD6 homolog B (S. cerevisiae)
Zebrafish(393140) LSM14B, SCD6 homolog B (S. cerevisiae)
chicken(771330) LSM14B, SCD6 homolog B (S. cerevisiae)
domestic cat(101085197) LSM14B, SCD6 homolog B (S. cerevisiae)
domestic guinea pig(100720206) LSM14B, SCD6 homolog B (S. cerevisiae)
naked mole-rat(101696573) LSM14B, SCD6 homolog B (S. cerevisiae)
sheep(101122208) LSM14B, SCD6 homolog B (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144703 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144703 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144703 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177727 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177727 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177727 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146211 MISSION® esiRNA esiRNA human LSM14B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144703 Rosetta Predictions human pricing
NM_177727 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364633 predicted 993
2 SASI_Hs02_00364634 predicted 386
3 SASI_Hs02_00364635 predicted 434
4 SASI_Hs02_00364636 predicted 1440
5 SASI_Hs02_00364637 predicted 684
6 SASI_Hs02_00364638 predicted 1118
7 SASI_Hs02_00364639 predicted 1129
8 SASI_Hs02_00364640 predicted 1371
9 SASI_Hs02_00364641 predicted 1208
10 SASI_Hs02_00364642 predicted 1450
11 SASI_Hs01_00243345 predicted 927
12 SASI_Hs01_00243346 predicted 978
13 SASI_Hs01_00243347 predicted 452
14 SASI_Hs01_00243348 predicted 857
15 SASI_Hs01_00243349 predicted 678
16 SASI_Hs01_00243350 predicted 767
17 SASI_Hs01_00243351 predicted 870
18 SASI_Hs01_00243352 predicted 568
19 SASI_Hs01_00243353 predicted 709
20 SASI_Hs01_00243354 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348092 predicted 407
2 SASI_Mm01_00044429 predicted 816
3 SASI_Mm01_00044430 predicted 1343
4 SASI_Mm01_00044434 predicted 596
5 SASI_Mm01_00044431 predicted 1403
6 SASI_Mm01_00044435 predicted 935
7 SASI_Mm02_00348093 predicted 885
8 SASI_Mm02_00348094 predicted 380
9 SASI_Mm02_00348095 predicted 421
10 SASI_Mm01_00044437 predicted 689
11 SASI_Mm01_00044432 predicted 718
12 SASI_Mm01_00044433 predicted 600
13 SASI_Mm01_00044436 predicted 968
14 SASI_Mm01_00044438 predicted 1153
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144703
LSM14B MISSION shRNA Bacterial Glycerol Stock
LSM14B, SCD6 homolog B (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-1004s1c1
Sequence:CCGGGAGACCCATACTGCTACTTGTCTCGAGACAAGTAGCAGTATGGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-681s1c1
Sequence:CCGGGCTGACAACCTGAATGCTAAACTCGAGTTTAGCATTCAGGTTGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-993s1c1
Sequence:CCGGGAATTTAAGAAGAGACCCATACTCGAGTATGGGTCTCTTCTTAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144703.2-350s21c1
Sequence:CCGGTGAAGACCGTCCCACAGATAGCTCGAGCTATCTGTGGGACGGTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-679s1c1
Sequence:CCGGCTGCTGACAACCTGAATGCTACTCGAGTAGCATTCAGGTTGTCAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-953s1c1
Sequence:CCGGGAGTGCAAATGCCCAGTTCAACTCGAGTTGAACTGGGCATTTGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-978s1c1
Sequence:CCGGGAGGAGCTTGACAAAGAATTTCTCGAGAAATTCTTTGTCAAGCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-941s1c1
Sequence:CCGGCTTTGATTTCGAGAGTGCAAACTCGAGTTTGCACTCTCGAAATCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144703.2-1608s21c1
Sequence:CCGGTTAGTTGCGCATAGCCTAATTCTCGAGAATTAGGCTATGCGCAACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144703.2-1382s21c1
Sequence:CCGGCCTACTGAAGTGGCGCATAACCTCGAGGTTATGCGCCACTTCAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144703
LSM14B MISSION shRNA shRNA Plasmid DNA
LSM14B, SCD6 homolog B (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-1004s1c1
Sequence:CCGGGAGACCCATACTGCTACTTGTCTCGAGACAAGTAGCAGTATGGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-681s1c1
Sequence:CCGGGCTGACAACCTGAATGCTAAACTCGAGTTTAGCATTCAGGTTGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-993s1c1
Sequence:CCGGGAATTTAAGAAGAGACCCATACTCGAGTATGGGTCTCTTCTTAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144703.2-350s21c1
Sequence:CCGGTGAAGACCGTCCCACAGATAGCTCGAGCTATCTGTGGGACGGTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-679s1c1
Sequence:CCGGCTGCTGACAACCTGAATGCTACTCGAGTAGCATTCAGGTTGTCAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-953s1c1
Sequence:CCGGGAGTGCAAATGCCCAGTTCAACTCGAGTTGAACTGGGCATTTGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-978s1c1
Sequence:CCGGGAGGAGCTTGACAAAGAATTTCTCGAGAAATTCTTTGTCAAGCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-941s1c1
Sequence:CCGGCTTTGATTTCGAGAGTGCAAACTCGAGTTTGCACTCTCGAAATCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144703.2-1608s21c1
Sequence:CCGGTTAGTTGCGCATAGCCTAATTCTCGAGAATTAGGCTATGCGCAACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144703.2-1382s21c1
Sequence:CCGGCCTACTGAAGTGGCGCATAACCTCGAGGTTATGCGCCACTTCAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144703
LSM14B MISSION shRNA Lentiviral Transduction Particles
LSM14B, SCD6 homolog B (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-1004s1c1
Sequence:CCGGGAGACCCATACTGCTACTTGTCTCGAGACAAGTAGCAGTATGGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-681s1c1
Sequence:CCGGGCTGACAACCTGAATGCTAAACTCGAGTTTAGCATTCAGGTTGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-993s1c1
Sequence:CCGGGAATTTAAGAAGAGACCCATACTCGAGTATGGGTCTCTTCTTAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144703.2-350s21c1
Sequence:CCGGTGAAGACCGTCCCACAGATAGCTCGAGCTATCTGTGGGACGGTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-679s1c1
Sequence:CCGGCTGCTGACAACCTGAATGCTACTCGAGTAGCATTCAGGTTGTCAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-953s1c1
Sequence:CCGGGAGTGCAAATGCCCAGTTCAACTCGAGTTGAACTGGGCATTTGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-978s1c1
Sequence:CCGGGAGGAGCTTGACAAAGAATTTCTCGAGAAATTCTTTGTCAAGCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144703.1-941s1c1
Sequence:CCGGCTTTGATTTCGAGAGTGCAAACTCGAGTTTGCACTCTCGAAATCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144703.2-1608s21c1
Sequence:CCGGTTAGTTGCGCATAGCCTAATTCTCGAGAATTAGGCTATGCGCAACTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144703.2-1382s21c1
Sequence:CCGGCCTACTGAAGTGGCGCATAACCTCGAGGTTATGCGCCACTTCAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177727
VALIDATED
LSM14B MISSION shRNA Bacterial Glycerol Stock
LSM14B, SCD6 homolog B (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177727.2-1149s1c1
Sequence:CCGGGCCTAACTGTTACTATGACAACTCGAGTTGTCATAGTAACAGTTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177727.2-1188s1c1
Sequence:CCGGCAACATCTCTTCTGAACTCAACTCGAGTTGAGTTCAGAAGAGATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189791    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177727.2-1423s1c1
Sequence:CCGGGCCCTGAAGATAAGGACAGAACTCGAGTTCTGTCCTTATCTTCAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177727.2-917s1c1
Sequence:CCGGGAAATCGTTCCAGAGGACAAACTCGAGTTTGTCCTCTGGAACGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177727.2-711s1c1
Sequence:CCGGCCAGACTAGTTCTGTTGATAACTCGAGTTATCAACAGAACTAGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177727.2-941s1c1
Sequence:CCGGGTCCAACTAACGTTAAGGAAACTCGAGTTTCCTTAACGTTAGTTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177727.2-1540s1c1
Sequence:CCGGGTCTGAGATTTAGAACCACTTCTCGAGAAGTGGTTCTAAATCTCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177727.2-1495s1c1
Sequence:CCGGCCCTCATACTGCTACTTAGTTCTCGAGAACTAAGTAGCAGTATGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177727.2-940s1c1
Sequence:CCGGCGTCCAACTAACGTTAAGGAACTCGAGTTCCTTAACGTTAGTTGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177727
VALIDATED
LSM14B MISSION shRNA shRNA Plasmid DNA
LSM14B, SCD6 homolog B (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177727.2-1149s1c1
Sequence:CCGGGCCTAACTGTTACTATGACAACTCGAGTTGTCATAGTAACAGTTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177727.2-1188s1c1
Sequence:CCGGCAACATCTCTTCTGAACTCAACTCGAGTTGAGTTCAGAAGAGATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189791    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177727.2-1423s1c1
Sequence:CCGGGCCCTGAAGATAAGGACAGAACTCGAGTTCTGTCCTTATCTTCAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177727.2-917s1c1
Sequence:CCGGGAAATCGTTCCAGAGGACAAACTCGAGTTTGTCCTCTGGAACGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177727.2-711s1c1
Sequence:CCGGCCAGACTAGTTCTGTTGATAACTCGAGTTATCAACAGAACTAGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177727.2-941s1c1
Sequence:CCGGGTCCAACTAACGTTAAGGAAACTCGAGTTTCCTTAACGTTAGTTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177727.2-1540s1c1
Sequence:CCGGGTCTGAGATTTAGAACCACTTCTCGAGAAGTGGTTCTAAATCTCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177727.2-1495s1c1
Sequence:CCGGCCCTCATACTGCTACTTAGTTCTCGAGAACTAAGTAGCAGTATGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177727.2-940s1c1
Sequence:CCGGCGTCCAACTAACGTTAAGGAACTCGAGTTCCTTAACGTTAGTTGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177727
VALIDATED
LSM14B MISSION shRNA Lentiviral Transduction Particles
LSM14B, SCD6 homolog B (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177727.2-1149s1c1
Sequence:CCGGGCCTAACTGTTACTATGACAACTCGAGTTGTCATAGTAACAGTTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177727.2-1188s1c1
Sequence:CCGGCAACATCTCTTCTGAACTCAACTCGAGTTGAGTTCAGAAGAGATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189791    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177727.2-1423s1c1
Sequence:CCGGGCCCTGAAGATAAGGACAGAACTCGAGTTCTGTCCTTATCTTCAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177727.2-917s1c1
Sequence:CCGGGAAATCGTTCCAGAGGACAAACTCGAGTTTGTCCTCTGGAACGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177727.2-711s1c1
Sequence:CCGGCCAGACTAGTTCTGTTGATAACTCGAGTTATCAACAGAACTAGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177727.2-941s1c1
Sequence:CCGGGTCCAACTAACGTTAAGGAAACTCGAGTTTCCTTAACGTTAGTTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177727.2-1540s1c1
Sequence:CCGGGTCTGAGATTTAGAACCACTTCTCGAGAAGTGGTTCTAAATCTCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177727.2-1495s1c1
Sequence:CCGGCCCTCATACTGCTACTTAGTTCTCGAGAACTAAGTAGCAGTATGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177727.2-940s1c1
Sequence:CCGGCGTCCAACTAACGTTAAGGAACTCGAGTTCCTTAACGTTAGTTGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)