EMAIL THIS PAGE TO A FRIEND

LSM1

LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)

75 Gene Product Result for
Synonyms: CASM YJL124C
UniProtKB ID: O15116, B2R5E6
Gene ID:
Human(27257) Summary: This gene encodes a member of the LSm family of RNA-binding proteins. LSm proteins form stable heteromers that bind specifically to the 3'-terminal oligo(U) tract of U6 snRNA and may play a role in pre-mRNA splicing by mediating U4/U6 snRNP formation. Increased expression of this gene may play a role in cellular transformation and the progression of several malignancies including lung cancer, mesothelioma and breast cancer. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, Nov 2011]
Mouse(67207) LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Rat(364624) LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Zebrafish(445157) LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
cow(535447) LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
domestic cat(101088074) LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
dog(475587) LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
chicken(426775) LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
fruit fly(37413) CG4279 gene product from transcript CG4279-RA
sheep(101111937) LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
naked mole-rat(101708340) LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
domestic guinea pig(100732344) LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014462 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026032 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026032 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026032 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014462 Rosetta Predictions human pricing
NM_001108876 Rosetta Predictions rat pricing
NM_026032 Rosetta Predictions mouse pricing
XM_357867 Rosetta Predictions mouse pricing
XM_987686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232905 predicted 496
2 SASI_Hs01_00232906 predicted 399
3 SASI_Hs01_00232907 predicted 207
4 SASI_Hs01_00232908 predicted 323
5 SASI_Hs01_00232909 predicted 300
6 SASI_Hs01_00232911 predicted 357
7 SASI_Hs01_00232912 predicted 395
8 SASI_Hs01_00232913 predicted 210
9 SASI_Hs01_00232914 predicted 209
10 SASI_Hs02_00345682 predicted 235
11 SASI_Hs01_00232910 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108876 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242955 predicted 563
2 SASI_Rn02_00242956 predicted 406
3 SASI_Rn02_00242957 predicted 560
4 SASI_Rn02_00242958 predicted 513
5 SASI_Rn02_00242959 predicted 398
6 SASI_Rn02_00242960 predicted 597
7 SASI_Rn02_00242961 predicted 510
8 SASI_Rn02_00242962 predicted 490
9 SASI_Rn02_00242963 predicted 616
10 SASI_Rn02_00242964 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026032 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329507 predicted 968
2 SASI_Mm02_00329508 predicted 217
3 SASI_Mm02_00329509 predicted 409
4 SASI_Mm02_00329510 predicted 280
5 SASI_Mm02_00329511 predicted 472
6 SASI_Mm02_00329512 predicted 460
7 SASI_Mm02_00329513 predicted 811
8 SASI_Mm02_00329514 predicted 950
9 SASI_Mm02_00329515 predicted 512
10 SASI_Mm02_00329516 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_357867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216321 predicted 511
2 SASI_Mm01_00216322 predicted 697
3 SASI_Mm01_00216323 predicted 569
4 SASI_Mm01_00216324 predicted 461
5 SASI_Mm01_00216325 predicted 765
6 SASI_Mm01_00216326 predicted 748
7 SASI_Mm01_00216327 predicted 803
8 SASI_Mm01_00216328 predicted 427
9 SASI_Mm01_00216329 predicted 693
10 SASI_Mm01_00216330 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_987686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219397 predicted 717
2 SASI_Mm01_00219398 predicted 964
3 SASI_Mm01_00219399 predicted 531
4 SASI_Mm01_00219400 predicted 468
5 SASI_Mm01_00219401 predicted 444
6 SASI_Mm01_00219402 predicted 584
7 SASI_Mm01_00219403 predicted 505
8 SASI_Mm01_00219404 predicted 605
9 SASI_Mm01_00219405 predicted 710
10 SASI_Mm01_00219406 predicted 816
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014462
VALIDATED
LSM1 MISSION shRNA Bacterial Glycerol Stock
LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_014462.1-729s21c1
Sequence:CCGGGCAACATGAAGAAATCGTGTACTCGAGTACACGATTTCTTCATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014462.1-399s21c1
Sequence:CCGGGTGGTCCTACTAGGAGAAATACTCGAGTATTTCTCCTAGTAGGACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014462.1-301s21c1
Sequence:CCGGTTGCAAACTTAGTGCTACATCCTCGAGGATGTAGCACTAAGTTTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014462.1-452s21c1
Sequence:CCGGGCAAGTATCCATTGAAGAAATCTCGAGATTTCTTCAATGGATACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014462.1-240s21c1
Sequence:CCGGCACTTGGTTCTGCTTCGAGATCTCGAGATCTCGAAGCAGAACCAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014462.1-330s1c1
Sequence:CCGGGAGCGTATTCATGTGGGCAAACTCGAGTTTGCCCACATGAATACGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014462.1-240s1c1
Sequence:CCGGCACTTGGTTCTGCTTCGAGATCTCGAGATCTCGAAGCAGAACCAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014462.1-566s1c1
Sequence:CCGGAGCAGATACTCTTGATGAGTACTCGAGTACTCATCAAGAGTATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014462.1-399s1c1
Sequence:CCGGGTGGTCCTACTAGGAGAAATACTCGAGTATTTCTCCTAGTAGGACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014462.1-452s1c1
Sequence:CCGGGCAAGTATCCATTGAAGAAATCTCGAGATTTCTTCAATGGATACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014462
VALIDATED
LSM1 MISSION shRNA shRNA Plasmid DNA
LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_014462.1-729s21c1
Sequence:CCGGGCAACATGAAGAAATCGTGTACTCGAGTACACGATTTCTTCATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014462.1-399s21c1
Sequence:CCGGGTGGTCCTACTAGGAGAAATACTCGAGTATTTCTCCTAGTAGGACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014462.1-301s21c1
Sequence:CCGGTTGCAAACTTAGTGCTACATCCTCGAGGATGTAGCACTAAGTTTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014462.1-452s21c1
Sequence:CCGGGCAAGTATCCATTGAAGAAATCTCGAGATTTCTTCAATGGATACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014462.1-240s21c1
Sequence:CCGGCACTTGGTTCTGCTTCGAGATCTCGAGATCTCGAAGCAGAACCAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014462.1-330s1c1
Sequence:CCGGGAGCGTATTCATGTGGGCAAACTCGAGTTTGCCCACATGAATACGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014462.1-240s1c1
Sequence:CCGGCACTTGGTTCTGCTTCGAGATCTCGAGATCTCGAAGCAGAACCAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014462.1-566s1c1
Sequence:CCGGAGCAGATACTCTTGATGAGTACTCGAGTACTCATCAAGAGTATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014462.1-399s1c1
Sequence:CCGGGTGGTCCTACTAGGAGAAATACTCGAGTATTTCTCCTAGTAGGACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014462.1-452s1c1
Sequence:CCGGGCAAGTATCCATTGAAGAAATCTCGAGATTTCTTCAATGGATACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014462
VALIDATED
LSM1 MISSION shRNA Lentiviral Transduction Particles
LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_014462.1-729s21c1
Sequence:CCGGGCAACATGAAGAAATCGTGTACTCGAGTACACGATTTCTTCATGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014462.1-399s21c1
Sequence:CCGGGTGGTCCTACTAGGAGAAATACTCGAGTATTTCTCCTAGTAGGACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014462.1-301s21c1
Sequence:CCGGTTGCAAACTTAGTGCTACATCCTCGAGGATGTAGCACTAAGTTTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014462.1-452s21c1
Sequence:CCGGGCAAGTATCCATTGAAGAAATCTCGAGATTTCTTCAATGGATACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014462.1-240s21c1
Sequence:CCGGCACTTGGTTCTGCTTCGAGATCTCGAGATCTCGAAGCAGAACCAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014462.1-330s1c1
Sequence:CCGGGAGCGTATTCATGTGGGCAAACTCGAGTTTGCCCACATGAATACGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014462.1-240s1c1
Sequence:CCGGCACTTGGTTCTGCTTCGAGATCTCGAGATCTCGAAGCAGAACCAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014462.1-566s1c1
Sequence:CCGGAGCAGATACTCTTGATGAGTACTCGAGTACTCATCAAGAGTATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014462.1-399s1c1
Sequence:CCGGGTGGTCCTACTAGGAGAAATACTCGAGTATTTCTCCTAGTAGGACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014462.1-452s1c1
Sequence:CCGGGCAAGTATCCATTGAAGAAATCTCGAGATTTCTTCAATGGATACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026032
VALIDATED
LSM1 MISSION shRNA Bacterial Glycerol Stock
LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026032.1-338s21c1
Sequence:CCGGCCCTTCAGCAAGTGTCTATTGCTCGAGCAATAGACACTTGCTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026032.1-185s21c1
Sequence:CCGGTTGATCAATTTGCTAACTTAGCTCGAGCTAAGTTAGCAAATTGATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026032.1-147s21c1
Sequence:CCGGTCGAGATGGAAGAACACTTATCTCGAGATAAGTGTTCTTCCATCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026032.1-1504s21c1
Sequence:CCGGCAGTAATTTATCTCGGATATACTCGAGTATATCCGAGATAAATTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026032.1-461s21c1
Sequence:CCGGCAGACACTCTGGACGAGTACTCTCGAGAGTACTCGTCCAGAGTGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026032
VALIDATED
LSM1 MISSION shRNA shRNA Plasmid DNA
LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026032.1-338s21c1
Sequence:CCGGCCCTTCAGCAAGTGTCTATTGCTCGAGCAATAGACACTTGCTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026032.1-185s21c1
Sequence:CCGGTTGATCAATTTGCTAACTTAGCTCGAGCTAAGTTAGCAAATTGATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026032.1-147s21c1
Sequence:CCGGTCGAGATGGAAGAACACTTATCTCGAGATAAGTGTTCTTCCATCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026032.1-1504s21c1
Sequence:CCGGCAGTAATTTATCTCGGATATACTCGAGTATATCCGAGATAAATTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026032.1-461s21c1
Sequence:CCGGCAGACACTCTGGACGAGTACTCTCGAGAGTACTCGTCCAGAGTGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026032
VALIDATED
LSM1 MISSION shRNA Lentiviral Transduction Particles
LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026032.1-338s21c1
Sequence:CCGGCCCTTCAGCAAGTGTCTATTGCTCGAGCAATAGACACTTGCTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026032.1-185s21c1
Sequence:CCGGTTGATCAATTTGCTAACTTAGCTCGAGCTAAGTTAGCAAATTGATCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026032.1-147s21c1
Sequence:CCGGTCGAGATGGAAGAACACTTATCTCGAGATAAGTGTTCTTCCATCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026032.1-1504s21c1
Sequence:CCGGCAGTAATTTATCTCGGATATACTCGAGTATATCCGAGATAAATTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026032.1-461s21c1
Sequence:CCGGCAGACACTCTGGACGAGTACTCTCGAGAGTACTCGTCCAGAGTGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)