EMAIL THIS PAGE TO A FRIEND

LSM2

LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)

74 Gene Product Result for
Synonyms: C6orf28 G7B YBL026W snRNP
UniProtKB ID: Q9Y333, Q6FGG1
Gene ID:
Human(57819) Summary: This gene encodes a member of the LSm family of RNA-binding proteins. LSm proteins form stable heteromers that bind specifically to the 3'-terminal oligo(U) tract of U6 snRNA and may play a role in pre-mRNA splicing by mediating U4/U6 snRNP formation. Pseudogenes of this gene are located on the short arm of chromosomes 6 and 19. [provided by RefSeq, Nov 2011]
Mouse(27756) LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Rat(684148) LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Goat(100861322) LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)
sheep(101117372) LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)
naked mole-rat(101700991) LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)
domestic guinea pig(100717756) LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)
dog(474849) LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)
domestic cat(101101054) LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)
cow(538662) LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2502078 Anti-LSM2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, pig, rat, canine, bovine
ELISA, western blot pricing
SAB1412874 Anti-LSM2 antibody produced in mouse purified immunoglobulin human
western blot pricing
AV40963 Anti-LSM2 antibody produced in rabbit IgG fraction of antiserum rabbit, human, zebrafish, rat, pig, horse, mouse, bovine, guinea pig, canine
immunohistochemistry, western blot pricing
HPA066718 Anti-LSM2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021177 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147121 MISSION® esiRNA esiRNA human AL662834.8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021177 Rosetta Predictions human pricing
XM_001060812 Rosetta Predictions rat pricing
XM_001060866 Rosetta Predictions rat pricing
NM_001110101 Rosetta Predictions mouse pricing
NM_030597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194663 predicted 300
2 SASI_Hs01_00194664 predicted 362
3 SASI_Hs01_00194665 predicted 337
4 SASI_Hs02_00354743 predicted 340
5 SASI_Hs01_00194666 predicted 361
6 SASI_Hs01_00194667 predicted 352
7 SASI_Hs01_00194668 predicted 289
8 SASI_Hs01_00194669 predicted 289
9 SASI_Hs01_00194670 predicted 248
10 SASI_Hs01_00194671 predicted 244
11 SASI_Hs01_00194672 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060812 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297801 predicted 227
2 SASI_Rn02_00297802 predicted 211
3 SASI_Rn02_00297803 predicted 258
4 SASI_Rn02_00297804 predicted 257
5 SASI_Rn02_00297805 predicted 261
6 SASI_Rn02_00297806 predicted 198
7 SASI_Rn02_00297807 predicted 257
8 SASI_Rn02_00297808 predicted 224
9 SASI_Rn02_00297809 predicted 231
10 SASI_Rn02_00297810 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297971 predicted 331
2 SASI_Rn02_00297972 predicted 312
3 SASI_Rn02_00297973 predicted 365
4 SASI_Rn02_00297974 predicted 243
5 SASI_Rn02_00297975 predicted 243
6 SASI_Rn02_00297976 predicted 359
7 SASI_Rn02_00297977 predicted 254
8 SASI_Rn02_00297978 predicted 238
9 SASI_Rn02_00297979 predicted 244
10 SASI_Rn02_00297980 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110101 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304636 predicted 375
2 SASI_Mm02_00304637 predicted 314
3 SASI_Mm02_00304638 predicted 442
4 SASI_Mm02_00304639 predicted 540
5 SASI_Mm02_00304640 predicted 358
6 SASI_Mm02_00304641 predicted 583
7 SASI_Mm02_00304642 predicted 553
8 SASI_Mm02_00304643 predicted 454
9 SASI_Mm02_00304644 predicted 450
10 SASI_Mm02_00304645 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071841 predicted 383
2 SASI_Mm01_00071842 predicted 326
3 SASI_Mm02_00336794 predicted 454
4 SASI_Mm02_00336795 predicted 552
5 SASI_Mm02_00336796 predicted 601
6 SASI_Mm02_00336797 predicted 567
7 SASI_Mm02_00336798 predicted 468
8 SASI_Mm02_00336799 predicted 466
9 SASI_Mm02_00336800 predicted 249
10 SASI_Mm01_00071849 predicted 320
11 SASI_Mm01_00071843 predicted 388
12 SASI_Mm01_00071844 predicted 379
13 SASI_Mm01_00071845 predicted 378
14 SASI_Mm01_00071846 predicted 260
15 SASI_Mm01_00071847 predicted 392
16 SASI_Mm01_00071848 predicted 348
17 SASI_Mm01_00071850 predicted 222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021177
VALIDATED
LSM2 MISSION shRNA Bacterial Glycerol Stock
LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021177.3-249s21c1
Sequence:CCGGGATGTGGTCGTGGAACTAAAGCTCGAGCTTTAGTTCCACGACCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021177.3-309s21c1
Sequence:CCGGCAGTATCTCAACATCAAACTACTCGAGTAGTTTGATGTTGAGATACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021177.3-362s21c1
Sequence:CCGGCCCTCACATGTTATCAGTGAACTCGAGTTCACTGATAACATGTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021177.3-441s21c1
Sequence:CCGGGACACACAGTTGCTACAGGATCTCGAGATCCTGTAGCAACTGTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021177.3-637s21c1
Sequence:CCGGGAGTGGATGAGAGGAGTAATACTCGAGTATTACTCCTCTCATCCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021177.3-441s1c1
Sequence:CCGGGACACACAGTTGCTACAGGATCTCGAGATCCTGTAGCAACTGTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021177.3-350s1c1
Sequence:CCGGCCCTGAGAAATACCCTCACATCTCGAGATGTGAGGGTATTTCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021177.3-309s1c1
Sequence:CCGGCAGTATCTCAACATCAAACTACTCGAGTAGTTTGATGTTGAGATACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021177.3-362s1c1
Sequence:CCGGCCCTCACATGTTATCAGTGAACTCGAGTTCACTGATAACATGTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021177.3-521s1c1
Sequence:CCGGCCTCTTTCATTGGTGACCCATCTCGAGATGGGTCACCAATGAAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021177
VALIDATED
LSM2 MISSION shRNA shRNA Plasmid DNA
LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021177.3-249s21c1
Sequence:CCGGGATGTGGTCGTGGAACTAAAGCTCGAGCTTTAGTTCCACGACCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021177.3-309s21c1
Sequence:CCGGCAGTATCTCAACATCAAACTACTCGAGTAGTTTGATGTTGAGATACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021177.3-362s21c1
Sequence:CCGGCCCTCACATGTTATCAGTGAACTCGAGTTCACTGATAACATGTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021177.3-441s21c1
Sequence:CCGGGACACACAGTTGCTACAGGATCTCGAGATCCTGTAGCAACTGTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021177.3-637s21c1
Sequence:CCGGGAGTGGATGAGAGGAGTAATACTCGAGTATTACTCCTCTCATCCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021177.3-441s1c1
Sequence:CCGGGACACACAGTTGCTACAGGATCTCGAGATCCTGTAGCAACTGTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021177.3-350s1c1
Sequence:CCGGCCCTGAGAAATACCCTCACATCTCGAGATGTGAGGGTATTTCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021177.3-309s1c1
Sequence:CCGGCAGTATCTCAACATCAAACTACTCGAGTAGTTTGATGTTGAGATACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021177.3-362s1c1
Sequence:CCGGCCCTCACATGTTATCAGTGAACTCGAGTTCACTGATAACATGTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021177.3-521s1c1
Sequence:CCGGCCTCTTTCATTGGTGACCCATCTCGAGATGGGTCACCAATGAAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021177
VALIDATED
LSM2 MISSION shRNA Lentiviral Transduction Particles
LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021177.3-249s21c1
Sequence:CCGGGATGTGGTCGTGGAACTAAAGCTCGAGCTTTAGTTCCACGACCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021177.3-309s21c1
Sequence:CCGGCAGTATCTCAACATCAAACTACTCGAGTAGTTTGATGTTGAGATACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021177.3-362s21c1
Sequence:CCGGCCCTCACATGTTATCAGTGAACTCGAGTTCACTGATAACATGTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021177.3-441s21c1
Sequence:CCGGGACACACAGTTGCTACAGGATCTCGAGATCCTGTAGCAACTGTGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021177.3-637s21c1
Sequence:CCGGGAGTGGATGAGAGGAGTAATACTCGAGTATTACTCCTCTCATCCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021177.3-441s1c1
Sequence:CCGGGACACACAGTTGCTACAGGATCTCGAGATCCTGTAGCAACTGTGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021177.3-350s1c1
Sequence:CCGGCCCTGAGAAATACCCTCACATCTCGAGATGTGAGGGTATTTCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021177.3-309s1c1
Sequence:CCGGCAGTATCTCAACATCAAACTACTCGAGTAGTTTGATGTTGAGATACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021177.3-362s1c1
Sequence:CCGGCCCTCACATGTTATCAGTGAACTCGAGTTCACTGATAACATGTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021177.3-521s1c1
Sequence:CCGGCCTCTTTCATTGGTGACCCATCTCGAGATGGGTCACCAATGAAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030597
VALIDATED
LSM2 MISSION shRNA Bacterial Glycerol Stock
LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030597.3-213s21c1
Sequence:CCGGGTGCTGTTGACGAGGACTTTGCTCGAGCAAAGTCCTCGTCAACAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030597.3-388s21c1
Sequence:CCGGCCCTCACATGTTATCAGTCAACTCGAGTTGACTGATAACATGTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030597.3-340s21c1
Sequence:CCGGCCTCAATATCAAACTAACCGACTCGAGTCGGTTAGTTTGATATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030597.3-602s21c1
Sequence:CCGGCCCAATACTTAAGGTGTGTTTCTCGAGAAACACACCTTAAGTATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030597.3-279s21c1
Sequence:CCGGTAGTCGTGGAACTCAAGAATGCTCGAGCATTCTTGAGTTCCACGACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030597.2-595s1c1
Sequence:CCGGCCCAATACTTAAGGTGTGTTTCTCGAGAAACACACCTTAAGTATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030597.2-381s1c1
Sequence:CCGGCCCTCACATGTTATCAGTCAACTCGAGTTGACTGATAACATGTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030597.2-333s1c1
Sequence:CCGGCCTCAATATCAAACTAACCGACTCGAGTCGGTTAGTTTGATATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030597.2-460s1c1
Sequence:CCGGGACACACAACTGCTACAGGATCTCGAGATCCTGTAGCAGTTGTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030597.2-325s1c1
Sequence:CCGGGACCAGTACCTCAATATCAAACTCGAGTTTGATATTGAGGTACTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030597
VALIDATED
LSM2 MISSION shRNA shRNA Plasmid DNA
LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030597.3-213s21c1
Sequence:CCGGGTGCTGTTGACGAGGACTTTGCTCGAGCAAAGTCCTCGTCAACAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030597.3-388s21c1
Sequence:CCGGCCCTCACATGTTATCAGTCAACTCGAGTTGACTGATAACATGTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030597.3-340s21c1
Sequence:CCGGCCTCAATATCAAACTAACCGACTCGAGTCGGTTAGTTTGATATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030597.3-602s21c1
Sequence:CCGGCCCAATACTTAAGGTGTGTTTCTCGAGAAACACACCTTAAGTATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030597.3-279s21c1
Sequence:CCGGTAGTCGTGGAACTCAAGAATGCTCGAGCATTCTTGAGTTCCACGACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030597.2-595s1c1
Sequence:CCGGCCCAATACTTAAGGTGTGTTTCTCGAGAAACACACCTTAAGTATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030597.2-381s1c1
Sequence:CCGGCCCTCACATGTTATCAGTCAACTCGAGTTGACTGATAACATGTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030597.2-333s1c1
Sequence:CCGGCCTCAATATCAAACTAACCGACTCGAGTCGGTTAGTTTGATATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030597.2-460s1c1
Sequence:CCGGGACACACAACTGCTACAGGATCTCGAGATCCTGTAGCAGTTGTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030597.2-325s1c1
Sequence:CCGGGACCAGTACCTCAATATCAAACTCGAGTTTGATATTGAGGTACTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030597
VALIDATED
LSM2 MISSION shRNA Lentiviral Transduction Particles
LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030597.3-213s21c1
Sequence:CCGGGTGCTGTTGACGAGGACTTTGCTCGAGCAAAGTCCTCGTCAACAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030597.3-388s21c1
Sequence:CCGGCCCTCACATGTTATCAGTCAACTCGAGTTGACTGATAACATGTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030597.3-340s21c1
Sequence:CCGGCCTCAATATCAAACTAACCGACTCGAGTCGGTTAGTTTGATATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030597.3-602s21c1
Sequence:CCGGCCCAATACTTAAGGTGTGTTTCTCGAGAAACACACCTTAAGTATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030597.3-279s21c1
Sequence:CCGGTAGTCGTGGAACTCAAGAATGCTCGAGCATTCTTGAGTTCCACGACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030597.2-595s1c1
Sequence:CCGGCCCAATACTTAAGGTGTGTTTCTCGAGAAACACACCTTAAGTATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030597.2-381s1c1
Sequence:CCGGCCCTCACATGTTATCAGTCAACTCGAGTTGACTGATAACATGTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030597.2-333s1c1
Sequence:CCGGCCTCAATATCAAACTAACCGACTCGAGTCGGTTAGTTTGATATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030597.2-460s1c1
Sequence:CCGGGACACACAACTGCTACAGGATCTCGAGATCCTGTAGCAGTTGTGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030597.2-325s1c1
Sequence:CCGGGACCAGTACCTCAATATCAAACTCGAGTTTGATATTGAGGTACTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)