EMAIL THIS PAGE TO A FRIEND

LSM4

LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)

55 Gene Product Result for
Synonyms: GRP YER112W
UniProtKB ID: Q9Y4Z0
Gene ID:
Human(25804) Summary: This gene encodes a member of the LSm family of RNA-binding proteins. LSm proteins form stable heteromers that bind specifically to the 3'-terminal oligo(U) tract of U6 snRNA and may play a role in pre-mRNA splicing by mediating U4/U6 snRNP formation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Mouse(50783) LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Rat(290647) LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Zebrafish(393669) LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)
cow(613634) LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)
domestic cat(101086377) LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)
dog(609922) LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)
chicken(420128) LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)
naked mole-rat(101720806) LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)
domestic guinea pig(100734882) LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015816 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015816 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015816 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012321 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012321 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012321 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155961 MISSION® esiRNA esiRNA human LSM4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012321 Rosetta Predictions human pricing
NM_001106073 Rosetta Predictions rat pricing
NM_015816 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012231 predicted 224
2 SASI_Hs01_00012234 predicted 196
3 SASI_Hs01_00012235 predicted 347
4 SASI_Hs02_00344106 predicted 795
5 SASI_Hs01_00012236 predicted 717
6 SASI_Hs02_00344107 predicted 721
7 SASI_Hs01_00012237 predicted 256
8 SASI_Hs01_00012238 predicted 238
9 SASI_Hs01_00012239 predicted 542
10 SASI_Hs01_00012240 predicted 817
11 SASI_Hs01_00012232 predicted 802
12 SASI_Hs01_00012233 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106073 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215362 predicted 282
2 SASI_Rn02_00215363 predicted 266
3 SASI_Rn02_00215364 predicted 389
4 SASI_Rn02_00215365 predicted 401
5 SASI_Rn02_00215366 predicted 395
6 SASI_Rn02_00215367 predicted 317
7 SASI_Rn02_00215368 predicted 381
8 SASI_Rn02_00215369 predicted 309
9 SASI_Rn02_00215370 predicted 291
10 SASI_Rn02_00215371 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323205 predicted 294
2 SASI_Mm02_00323206 predicted 298
3 SASI_Mm02_00323207 predicted 230
4 SASI_Mm01_00054207 predicted 433
5 SASI_Mm02_00323208 predicted 705
6 SASI_Mm02_00323209 predicted 288
7 SASI_Mm02_00323210 predicted 370
8 SASI_Mm02_00323211 predicted 311
9 SASI_Mm02_00323212 predicted 633
10 SASI_Mm02_00323213 predicted 306
11 SASI_Mm01_00054198 predicted 272
12 SASI_Mm01_00054199 predicted 373
13 SASI_Mm01_00054200 predicted 204
14 SASI_Mm01_00054201 predicted 550
15 SASI_Mm01_00054202 predicted 208
16 SASI_Mm01_00054203 predicted 456
17 SASI_Mm01_00054204 predicted 376
18 SASI_Mm01_00054205 predicted 481
19 SASI_Mm01_00054206 predicted 468
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015816
LSM4 MISSION shRNA Bacterial Glycerol Stock
LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015816.4-778s21c1
Sequence:CCGGGGTGCCTGTGGAGCCTTAGATCTCGAGATCTAAGGCTCCACAGGCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015816.4-756s21c1
Sequence:CCGGTTCTGGAAGGTTCCGAGTCTGCTCGAGCAGACTCGGAACCTTCCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015816.4-371s21c1
Sequence:CCGGTGGTGACAAGTTCTGGAGGATCTCGAGATCCTCCAGAACTTGTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015816.4-627s21c1
Sequence:CCGGGCAGGCAAACAGTGATCACTCCTCGAGGAGTGATCACTGTTTGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015816.4-437s21c1
Sequence:CCGGCCCTGATGAGATCATTGACATCTCGAGATGTCAATGATCTCATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015816.4-317s21c1
Sequence:CCGGCTGTGACAACTGGATGAACATCTCGAGATGTTCATCCAGTTGTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015816.4-410s21c1
Sequence:CCGGTGGCAGCACCATCAAGTACCTCTCGAGAGGTACTTGATGGTGCTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015816.1-580s1c1
Sequence:CCGGCCACTGACTCAGTTTCTGGAACTCGAGTTCCAGAAACTGAGTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015816.1-277s1c1
Sequence:CCGGCCCTGATGAGATCATTGACATCTCGAGATGTCAATGATCTCATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015816
LSM4 MISSION shRNA shRNA Plasmid DNA
LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015816.4-778s21c1
Sequence:CCGGGGTGCCTGTGGAGCCTTAGATCTCGAGATCTAAGGCTCCACAGGCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015816.4-756s21c1
Sequence:CCGGTTCTGGAAGGTTCCGAGTCTGCTCGAGCAGACTCGGAACCTTCCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015816.4-371s21c1
Sequence:CCGGTGGTGACAAGTTCTGGAGGATCTCGAGATCCTCCAGAACTTGTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015816.4-627s21c1
Sequence:CCGGGCAGGCAAACAGTGATCACTCCTCGAGGAGTGATCACTGTTTGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015816.4-437s21c1
Sequence:CCGGCCCTGATGAGATCATTGACATCTCGAGATGTCAATGATCTCATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015816.4-317s21c1
Sequence:CCGGCTGTGACAACTGGATGAACATCTCGAGATGTTCATCCAGTTGTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015816.4-410s21c1
Sequence:CCGGTGGCAGCACCATCAAGTACCTCTCGAGAGGTACTTGATGGTGCTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015816.1-580s1c1
Sequence:CCGGCCACTGACTCAGTTTCTGGAACTCGAGTTCCAGAAACTGAGTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015816.1-277s1c1
Sequence:CCGGCCCTGATGAGATCATTGACATCTCGAGATGTCAATGATCTCATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015816
LSM4 MISSION shRNA Lentiviral Transduction Particles
LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015816.4-778s21c1
Sequence:CCGGGGTGCCTGTGGAGCCTTAGATCTCGAGATCTAAGGCTCCACAGGCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015816.4-756s21c1
Sequence:CCGGTTCTGGAAGGTTCCGAGTCTGCTCGAGCAGACTCGGAACCTTCCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015816.4-371s21c1
Sequence:CCGGTGGTGACAAGTTCTGGAGGATCTCGAGATCCTCCAGAACTTGTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015816.4-627s21c1
Sequence:CCGGGCAGGCAAACAGTGATCACTCCTCGAGGAGTGATCACTGTTTGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015816.4-437s21c1
Sequence:CCGGCCCTGATGAGATCATTGACATCTCGAGATGTCAATGATCTCATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015816.4-317s21c1
Sequence:CCGGCTGTGACAACTGGATGAACATCTCGAGATGTTCATCCAGTTGTCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015816.4-410s21c1
Sequence:CCGGTGGCAGCACCATCAAGTACCTCTCGAGAGGTACTTGATGGTGCTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015816.1-580s1c1
Sequence:CCGGCCACTGACTCAGTTTCTGGAACTCGAGTTCCAGAAACTGAGTCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015816.1-277s1c1
Sequence:CCGGCCCTGATGAGATCATTGACATCTCGAGATGTCAATGATCTCATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012321
VALIDATED
LSM4 MISSION shRNA Bacterial Glycerol Stock
LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012321.3-390s21c1
Sequence:CCGGCGAGATCATCGACATGGTCAACTCGAGTTGACCATGTCGATGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012321.3-277s21c1
Sequence:CCGGATGAACATTAACCTGCGAGAACTCGAGTTCTCGCAGGTTAATGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012321.3-266s21c1
Sequence:CCGGGCGACAACTGGATGAACATTACTCGAGTAATGTTCATCCAGTTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012321.3-757s21c1
Sequence:CCGGCGGCAATTCTCCGGTTAGAAACTCGAGTTTCTAACCGGAGAATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012321.2-720s1c1
Sequence:CCGGCGGCAATTCTCCGGTTAGAAACTCGAGTTTCTAACCGGAGAATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012321.2-227s1c1
Sequence:CCGGCTGCGACAACTGGATGAACATCTCGAGATGTTCATCCAGTTGTCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012321.2-240s1c1
Sequence:CCGGATGAACATTAACCTGCGAGAACTCGAGTTCTCGCAGGTTAATGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012321.2-229s1c1
Sequence:CCGGGCGACAACTGGATGAACATTACTCGAGTAATGTTCATCCAGTTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012321.2-353s1c1
Sequence:CCGGCGAGATCATCGACATGGTCAACTCGAGTTGACCATGTCGATGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012321
VALIDATED
LSM4 MISSION shRNA shRNA Plasmid DNA
LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012321.3-390s21c1
Sequence:CCGGCGAGATCATCGACATGGTCAACTCGAGTTGACCATGTCGATGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012321.3-277s21c1
Sequence:CCGGATGAACATTAACCTGCGAGAACTCGAGTTCTCGCAGGTTAATGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012321.3-266s21c1
Sequence:CCGGGCGACAACTGGATGAACATTACTCGAGTAATGTTCATCCAGTTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012321.3-757s21c1
Sequence:CCGGCGGCAATTCTCCGGTTAGAAACTCGAGTTTCTAACCGGAGAATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012321.2-720s1c1
Sequence:CCGGCGGCAATTCTCCGGTTAGAAACTCGAGTTTCTAACCGGAGAATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012321.2-227s1c1
Sequence:CCGGCTGCGACAACTGGATGAACATCTCGAGATGTTCATCCAGTTGTCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012321.2-240s1c1
Sequence:CCGGATGAACATTAACCTGCGAGAACTCGAGTTCTCGCAGGTTAATGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012321.2-229s1c1
Sequence:CCGGGCGACAACTGGATGAACATTACTCGAGTAATGTTCATCCAGTTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012321.2-353s1c1
Sequence:CCGGCGAGATCATCGACATGGTCAACTCGAGTTGACCATGTCGATGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012321
VALIDATED
LSM4 MISSION shRNA Lentiviral Transduction Particles
LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012321.3-390s21c1
Sequence:CCGGCGAGATCATCGACATGGTCAACTCGAGTTGACCATGTCGATGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012321.3-277s21c1
Sequence:CCGGATGAACATTAACCTGCGAGAACTCGAGTTCTCGCAGGTTAATGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012321.3-266s21c1
Sequence:CCGGGCGACAACTGGATGAACATTACTCGAGTAATGTTCATCCAGTTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012321.3-757s21c1
Sequence:CCGGCGGCAATTCTCCGGTTAGAAACTCGAGTTTCTAACCGGAGAATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012321.2-720s1c1
Sequence:CCGGCGGCAATTCTCCGGTTAGAAACTCGAGTTTCTAACCGGAGAATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012321.2-227s1c1
Sequence:CCGGCTGCGACAACTGGATGAACATCTCGAGATGTTCATCCAGTTGTCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012321.2-240s1c1
Sequence:CCGGATGAACATTAACCTGCGAGAACTCGAGTTCTCGCAGGTTAATGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012321.2-229s1c1
Sequence:CCGGGCGACAACTGGATGAACATTACTCGAGTAATGTTCATCCAGTTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012321.2-353s1c1
Sequence:CCGGCGAGATCATCGACATGGTCAACTCGAGTTGACCATGTCGATGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)