EMAIL THIS PAGE TO A FRIEND

LSM6

LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)

71 Gene Product Result for
Synonyms: YDR378C
UniProtKB ID: P62312, Q4W5J5, Q9Y4Y8
Gene ID:
Human(11157) Summary: Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing.[supplied by OMIM, Apr 2004]
Mouse(78651) LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Rat(498934) LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Zebrafish(415167) LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)
cow(615916) LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)
domestic cat(101084955) LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)
dog(612329) LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)
chicken(422466) LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)
sheep(101109392) LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)
naked mole-rat(101699334) LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)
domestic guinea pig(100726691) LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007080 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030145 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030145 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030145 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009461 MISSION® esiRNA esiRNA targeting human LSM6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007080 Rosetta Predictions human pricing
NM_001126085 Rosetta Predictions rat pricing
NM_030145 Rosetta Predictions mouse pricing
XM_899706 Rosetta Predictions mouse pricing
XM_899712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078362 predicted 501
2 SASI_Hs02_00342911 predicted 641
3 SASI_Hs02_00342912 predicted 162
4 SASI_Hs02_00342913 predicted 590
5 SASI_Hs02_00342914 predicted 658
6 SASI_Hs01_00078368 predicted 314
7 SASI_Hs02_00342915 predicted 546
8 SASI_Hs01_00078370 predicted 535
9 SASI_Hs01_00078371 predicted 355
10 SASI_Hs02_00342916 predicted 330
11 SASI_Hs01_00078363 predicted 502
12 SASI_Hs01_00078364 predicted 476
13 SASI_Hs01_00078365 predicted 99
14 SASI_Hs01_00078366 predicted 536
15 SASI_Hs01_00078367 predicted 278
16 SASI_Hs01_00078369 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252863 predicted 212
2 SASI_Rn02_00252864 predicted 845
3 SASI_Rn02_00252865 predicted 378
4 SASI_Rn02_00252866 predicted 380
5 SASI_Rn02_00252867 predicted 707
6 SASI_Rn02_00252868 predicted 477
7 SASI_Rn02_00252869 predicted 586
8 SASI_Rn02_00252870 predicted 796
9 SASI_Rn02_00252871 predicted 469
10 SASI_Rn02_00252872 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336550 predicted 761
2 SASI_Mm02_00336551 predicted 611
3 SASI_Mm02_00336552 predicted 724
4 SASI_Mm02_00336553 predicted 611
5 SASI_Mm02_00336554 predicted 827
6 SASI_Mm02_00336555 predicted 485
7 SASI_Mm02_00336556 predicted 744
8 SASI_Mm02_00336557 predicted 757
9 SASI_Mm02_00336558 predicted 518
10 SASI_Mm02_00336559 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235348 predicted 757
2 SASI_Mm01_00235349 predicted 731
3 SASI_Mm01_00235350 predicted 715
4 SASI_Mm01_00235351 predicted 826
5 SASI_Mm01_00235352 predicted 742
6 SASI_Mm01_00235353 predicted 616
7 SASI_Mm01_00235354 predicted 405
8 SASI_Mm01_00235355 predicted 492
9 SASI_Mm01_00235356 predicted 484
10 SASI_Mm01_00235357 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265322 predicted 757
2 SASI_Mm01_00265323 predicted 726
3 SASI_Mm01_00265324 predicted 718
4 SASI_Mm01_00265325 predicted 834
5 SASI_Mm01_00265326 predicted 747
6 SASI_Mm01_00265327 predicted 613
7 SASI_Mm01_00265328 predicted 413
8 SASI_Mm01_00265329 predicted 496
9 SASI_Mm01_00265330 predicted 494
10 SASI_Mm01_00265331 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007080
LSM6 MISSION shRNA Bacterial Glycerol Stock
LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007080.2-595s21c1
Sequence:CCGGGTCAGTGTACAGAATGCTAAACTCGAGTTTAGCATTCTGTACACTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007080.2-286s21c1
Sequence:CCGGAGAATATGTAAATGGACAACTCTCGAGAGTTGTCCATTTACATATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007080.2-552s21c1
Sequence:CCGGGTTCTTTCACTTGTAAGTTTCCTCGAGGAAACTTACAAGTGAAAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007080.1-399s1c1
Sequence:CCGGGTGATACAATTTGTCCTCTTTCTCGAGAAAGAGGACAAATTGTATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007080.1-276s1c1
Sequence:CCGGCCGAGGAAACAATGTGTTGTACTCGAGTACAACACATTGTTTCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007080.1-129s1c1
Sequence:CCGGCGGACGACCAGTTGTGGTAAACTCGAGTTTACCACAACTGGTCGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007080.1-201s1c1
Sequence:CCGGCATGAATATAGCCCTGGAGCACTCGAGTGCTCCAGGGCTATATTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007080.1-300s1c1
Sequence:CCGGCAGTACACAGAAGAGACGGATCTCGAGATCCGTCTCTTCTGTGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007080
LSM6 MISSION shRNA shRNA Plasmid DNA
LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007080.2-595s21c1
Sequence:CCGGGTCAGTGTACAGAATGCTAAACTCGAGTTTAGCATTCTGTACACTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007080.2-286s21c1
Sequence:CCGGAGAATATGTAAATGGACAACTCTCGAGAGTTGTCCATTTACATATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007080.2-552s21c1
Sequence:CCGGGTTCTTTCACTTGTAAGTTTCCTCGAGGAAACTTACAAGTGAAAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007080.1-399s1c1
Sequence:CCGGGTGATACAATTTGTCCTCTTTCTCGAGAAAGAGGACAAATTGTATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007080.1-276s1c1
Sequence:CCGGCCGAGGAAACAATGTGTTGTACTCGAGTACAACACATTGTTTCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007080.1-129s1c1
Sequence:CCGGCGGACGACCAGTTGTGGTAAACTCGAGTTTACCACAACTGGTCGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007080.1-201s1c1
Sequence:CCGGCATGAATATAGCCCTGGAGCACTCGAGTGCTCCAGGGCTATATTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007080.1-300s1c1
Sequence:CCGGCAGTACACAGAAGAGACGGATCTCGAGATCCGTCTCTTCTGTGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007080
LSM6 MISSION shRNA Lentiviral Transduction Particles
LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007080.2-595s21c1
Sequence:CCGGGTCAGTGTACAGAATGCTAAACTCGAGTTTAGCATTCTGTACACTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007080.2-286s21c1
Sequence:CCGGAGAATATGTAAATGGACAACTCTCGAGAGTTGTCCATTTACATATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007080.2-552s21c1
Sequence:CCGGGTTCTTTCACTTGTAAGTTTCCTCGAGGAAACTTACAAGTGAAAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007080.1-399s1c1
Sequence:CCGGGTGATACAATTTGTCCTCTTTCTCGAGAAAGAGGACAAATTGTATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007080.1-276s1c1
Sequence:CCGGCCGAGGAAACAATGTGTTGTACTCGAGTACAACACATTGTTTCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007080.1-129s1c1
Sequence:CCGGCGGACGACCAGTTGTGGTAAACTCGAGTTTACCACAACTGGTCGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007080.1-201s1c1
Sequence:CCGGCATGAATATAGCCCTGGAGCACTCGAGTGCTCCAGGGCTATATTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007080.1-300s1c1
Sequence:CCGGCAGTACACAGAAGAGACGGATCTCGAGATCCGTCTCTTCTGTGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030145
LSM6 MISSION shRNA Bacterial Glycerol Stock
LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030145.2-580s21c1
Sequence:CCGGTTTGTTTCTCCAGGATTATTTCTCGAGAAATAATCCTGGAGAAACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030145.2-1238s21c1
Sequence:CCGGCTTACCCTCCTTCAATCTAAACTCGAGTTTAGATTGAAGGAGGGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030145.2-626s21c1
Sequence:CCGGCCATTGGTTGATTACGTATTCCTCGAGGAATACGTAATCAACCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030145.2-716s21c1
Sequence:CCGGACTCACCATCCGTACCATTTACTCGAGTAAATGGTACGGATGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030145.2-762s21c1
Sequence:CCGGGTTTCAGCCTTGGGCTATAAACTCGAGTTTATAGCCCAAGGCTGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030145
LSM6 MISSION shRNA shRNA Plasmid DNA
LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030145.2-580s21c1
Sequence:CCGGTTTGTTTCTCCAGGATTATTTCTCGAGAAATAATCCTGGAGAAACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030145.2-1238s21c1
Sequence:CCGGCTTACCCTCCTTCAATCTAAACTCGAGTTTAGATTGAAGGAGGGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030145.2-626s21c1
Sequence:CCGGCCATTGGTTGATTACGTATTCCTCGAGGAATACGTAATCAACCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030145.2-716s21c1
Sequence:CCGGACTCACCATCCGTACCATTTACTCGAGTAAATGGTACGGATGGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030145.2-762s21c1
Sequence:CCGGGTTTCAGCCTTGGGCTATAAACTCGAGTTTATAGCCCAAGGCTGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030145
LSM6 MISSION shRNA Lentiviral Transduction Particles
LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030145.2-580s21c1
Sequence:CCGGTTTGTTTCTCCAGGATTATTTCTCGAGAAATAATCCTGGAGAAACAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030145.2-1238s21c1
Sequence:CCGGCTTACCCTCCTTCAATCTAAACTCGAGTTTAGATTGAAGGAGGGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030145.2-626s21c1
Sequence:CCGGCCATTGGTTGATTACGTATTCCTCGAGGAATACGTAATCAACCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030145.2-716s21c1
Sequence:CCGGACTCACCATCCGTACCATTTACTCGAGTAAATGGTACGGATGGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030145.2-762s21c1
Sequence:CCGGGTTTCAGCCTTGGGCTATAAACTCGAGTTTATAGCCCAAGGCTGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)