EMAIL THIS PAGE TO A FRIEND

LSM7

LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)

50 Gene Product Result for
Synonyms: YNL147W
UniProtKB ID: Q9UK45
Gene ID:
Human(51690) Summary: Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing.[supplied by OMIM, Apr 2004]
Mouse(66094) LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Rat(362829) LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Zebrafish(573047) LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)
fruit fly(35003) CG13277 gene product from transcript CG13277-RA
domestic cat(101087712) LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)
cow(509920) LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)
dog(612170) LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)
chicken(420055) LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)
domestic guinea pig(100719633) LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)
naked mole-rat(101709127) LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)
sheep(101121092) LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025349 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025349 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025349 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016199 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016199 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016199 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016199 Rosetta Predictions human pricing
NM_001108732 Rosetta Predictions rat pricing
NM_025349 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161599 predicted 276
2 SASI_Hs02_00349028 predicted 208
3 SASI_Hs02_00349029 predicted 227
4 SASI_Hs02_00349030 predicted 197
5 SASI_Hs02_00349031 predicted 216
6 SASI_Hs02_00349032 predicted 220
7 SASI_Hs02_00349033 predicted 216
8 SASI_Hs01_00161600 predicted 275
9 SASI_Hs01_00161601 predicted 427
10 SASI_Hs01_00161602 predicted 133
11 SASI_Hs01_00161603 predicted 353
12 SASI_Hs01_00161604 predicted 84
13 SASI_Hs01_00161605 predicted 101
14 SASI_Hs01_00161606 predicted 364
15 SASI_Hs01_00161607 predicted 94
16 SASI_Hs01_00161608 predicted 69
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108732 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241535 predicted 65
2 SASI_Rn02_00241536 predicted 244
3 SASI_Rn02_00241537 predicted 51
4 SASI_Rn02_00241538 predicted 53
5 SASI_Rn02_00241539 predicted 60
6 SASI_Rn02_00241540 predicted 161
7 SASI_Rn02_00241541 predicted 162
8 SASI_Rn02_00241542 predicted 85
9 SASI_Rn02_00241543 predicted 78
10 SASI_Rn02_00241544 predicted 118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025349 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168031 predicted 68
2 SASI_Mm01_00168032 predicted 134
3 SASI_Mm01_00168033 predicted 50
4 SASI_Mm01_00168034 predicted 189
5 SASI_Mm01_00168035 predicted 120
6 SASI_Mm01_00168036 predicted 236
7 SASI_Mm01_00168037 predicted 135
8 SASI_Mm01_00168038 predicted 93
9 SASI_Mm01_00168039 predicted 325
10 SASI_Mm01_00168040 predicted 49
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025349
LSM7 MISSION shRNA Bacterial Glycerol Stock
LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025349.2-141s21c1
Sequence:CCGGTTTGACCCACTGCTCAACCTGCTCGAGCAGGTTGAGCAGTGGGTCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025349.1-66s1c1
Sequence:CCGGCCTCTCCAAGTACATCGATAACTCGAGTTATCGATGTACTTGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025349.1-174s1c1
Sequence:CCGGGACCATGGAGTACATGAGAGACTCGAGTCTCTCATGTACTCCATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025349.1-124s1c1
Sequence:CCGGAGCGGTATCCTGAAGGGCTTTCTCGAGAAAGCCCTTCAGGATACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025349.1-204s1c1
Sequence:CCGGCCAGTACAAGCTGACGGAGGACTCGAGTCCTCCGTCAGCTTGTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025349.1-84s1c1
Sequence:CCGGTAAGACCATTCGGGTGAAGTTCTCGAGAACTTCACCCGAATGGTCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025349.2-73s21c1
Sequence:CCGGAGTACATCGATAAGACCATTCCTCGAGGAATGGTCTTATCGATGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025349.2-181s21c1
Sequence:CCGGAGTACATGAGAGACCCTGATGCTCGAGCATCAGGGTCTCTCATGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025349
LSM7 MISSION shRNA shRNA Plasmid DNA
LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025349.2-141s21c1
Sequence:CCGGTTTGACCCACTGCTCAACCTGCTCGAGCAGGTTGAGCAGTGGGTCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025349.1-66s1c1
Sequence:CCGGCCTCTCCAAGTACATCGATAACTCGAGTTATCGATGTACTTGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025349.1-174s1c1
Sequence:CCGGGACCATGGAGTACATGAGAGACTCGAGTCTCTCATGTACTCCATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025349.1-124s1c1
Sequence:CCGGAGCGGTATCCTGAAGGGCTTTCTCGAGAAAGCCCTTCAGGATACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025349.1-204s1c1
Sequence:CCGGCCAGTACAAGCTGACGGAGGACTCGAGTCCTCCGTCAGCTTGTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025349.1-84s1c1
Sequence:CCGGTAAGACCATTCGGGTGAAGTTCTCGAGAACTTCACCCGAATGGTCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025349.2-73s21c1
Sequence:CCGGAGTACATCGATAAGACCATTCCTCGAGGAATGGTCTTATCGATGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025349.2-181s21c1
Sequence:CCGGAGTACATGAGAGACCCTGATGCTCGAGCATCAGGGTCTCTCATGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025349
LSM7 MISSION shRNA Lentiviral Transduction Particles
LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025349.2-141s21c1
Sequence:CCGGTTTGACCCACTGCTCAACCTGCTCGAGCAGGTTGAGCAGTGGGTCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025349.1-66s1c1
Sequence:CCGGCCTCTCCAAGTACATCGATAACTCGAGTTATCGATGTACTTGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025349.1-174s1c1
Sequence:CCGGGACCATGGAGTACATGAGAGACTCGAGTCTCTCATGTACTCCATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025349.1-124s1c1
Sequence:CCGGAGCGGTATCCTGAAGGGCTTTCTCGAGAAAGCCCTTCAGGATACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025349.1-204s1c1
Sequence:CCGGCCAGTACAAGCTGACGGAGGACTCGAGTCCTCCGTCAGCTTGTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025349.1-84s1c1
Sequence:CCGGTAAGACCATTCGGGTGAAGTTCTCGAGAACTTCACCCGAATGGTCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025349.2-73s21c1
Sequence:CCGGAGTACATCGATAAGACCATTCCTCGAGGAATGGTCTTATCGATGTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025349.2-181s21c1
Sequence:CCGGAGTACATGAGAGACCCTGATGCTCGAGCATCAGGGTCTCTCATGTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016199
VALIDATED
LSM7 MISSION shRNA Bacterial Glycerol Stock
LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016199.1-66s1c1
Sequence:CCGGCGACAAGACGATCCGGGTAAACTCGAGTTTACCCGGATCGTCTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016199.1-249s1c1
Sequence:CCGGCGTGGTGCTAATCTGCCCGCACTCGAGTGCGGGCAGATTAGCACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016199.1-42s1c1
Sequence:CCGGCATCTTGGACTTGTCCAAGTACTCGAGTACTTGGACAAGTCCAAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016199.1-186s1c1
Sequence:CCGGCGACCAGTACAAGCTCACGGACTCGAGTCCGTGAGCTTGTACTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016199.2-226s21c1
Sequence:CCGGCGACCAGTACAAGCTCACGGACTCGAGTCCGTGAGCTTGTACTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_016199.1-102s1c1
Sequence:CCGGCGAAGCCAGTGGAATCCTGAACTCGAGTTCAGGATTCCACTGGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016199.2-106s21c1
Sequence:CCGGCGACAAGACGATCCGGGTAAACTCGAGTTTACCCGGATCGTCTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016199.2-142s21c1
Sequence:CCGGCGAAGCCAGTGGAATCCTGAACTCGAGTTCAGGATTCCACTGGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016199.2-82s21c1
Sequence:CCGGCATCTTGGACTTGTCCAAGTACTCGAGTACTTGGACAAGTCCAAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016199
VALIDATED
LSM7 MISSION shRNA shRNA Plasmid DNA
LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016199.1-66s1c1
Sequence:CCGGCGACAAGACGATCCGGGTAAACTCGAGTTTACCCGGATCGTCTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016199.1-249s1c1
Sequence:CCGGCGTGGTGCTAATCTGCCCGCACTCGAGTGCGGGCAGATTAGCACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016199.1-42s1c1
Sequence:CCGGCATCTTGGACTTGTCCAAGTACTCGAGTACTTGGACAAGTCCAAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016199.1-186s1c1
Sequence:CCGGCGACCAGTACAAGCTCACGGACTCGAGTCCGTGAGCTTGTACTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016199.2-226s21c1
Sequence:CCGGCGACCAGTACAAGCTCACGGACTCGAGTCCGTGAGCTTGTACTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_016199.1-102s1c1
Sequence:CCGGCGAAGCCAGTGGAATCCTGAACTCGAGTTCAGGATTCCACTGGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016199.2-106s21c1
Sequence:CCGGCGACAAGACGATCCGGGTAAACTCGAGTTTACCCGGATCGTCTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016199.2-142s21c1
Sequence:CCGGCGAAGCCAGTGGAATCCTGAACTCGAGTTCAGGATTCCACTGGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016199.2-82s21c1
Sequence:CCGGCATCTTGGACTTGTCCAAGTACTCGAGTACTTGGACAAGTCCAAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016199
VALIDATED
LSM7 MISSION shRNA Lentiviral Transduction Particles
LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016199.1-66s1c1
Sequence:CCGGCGACAAGACGATCCGGGTAAACTCGAGTTTACCCGGATCGTCTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016199.1-249s1c1
Sequence:CCGGCGTGGTGCTAATCTGCCCGCACTCGAGTGCGGGCAGATTAGCACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016199.1-42s1c1
Sequence:CCGGCATCTTGGACTTGTCCAAGTACTCGAGTACTTGGACAAGTCCAAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016199.1-186s1c1
Sequence:CCGGCGACCAGTACAAGCTCACGGACTCGAGTCCGTGAGCTTGTACTGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016199.2-226s21c1
Sequence:CCGGCGACCAGTACAAGCTCACGGACTCGAGTCCGTGAGCTTGTACTGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_016199.1-102s1c1
Sequence:CCGGCGAAGCCAGTGGAATCCTGAACTCGAGTTCAGGATTCCACTGGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016199.2-106s21c1
Sequence:CCGGCGACAAGACGATCCGGGTAAACTCGAGTTTACCCGGATCGTCTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016199.2-142s21c1
Sequence:CCGGCGAAGCCAGTGGAATCCTGAACTCGAGTTCAGGATTCCACTGGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016199.2-82s21c1
Sequence:CCGGCATCTTGGACTTGTCCAAGTACTCGAGTACTTGGACAAGTCCAAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)