EMAIL THIS PAGE TO A FRIEND

LSMD1

LSM domain containing 1

43 Gene Product Result for
Synonyms: PFAAP2
UniProtKB ID: Q9BRA0, Q8N4M0
Gene ID:
Mouse(78304) LSM domain containing 1
Rat(287429) LSM domain containing 1
Zebrafish(335819) LSM domain containing 1
chicken(426258) LSM domain containing 1
domestic cat(101100516) LSM domain containing 1
cow(538931) LSM domain containing 1
dog(479488) LSM domain containing 1
sheep(101104764) LSM domain containing 1
naked mole-rat(101705076) LSM domain containing 1
domestic guinea pig(100734142) LSM domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032356 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030083 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030083 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030083 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032356 Rosetta Predictions human pricing
NM_001105794 Rosetta Predictions rat pricing
NM_030083 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175436 predicted 710
2 SASI_Hs01_00175437 predicted 729
3 SASI_Hs01_00175438 predicted 546
4 SASI_Hs01_00175439 predicted 479
5 SASI_Hs01_00175440 predicted 620
6 SASI_Hs01_00175441 predicted 626
7 SASI_Hs01_00175442 predicted 620
8 SASI_Hs01_00175443 predicted 738
9 SASI_Hs01_00175444 predicted 704
10 SASI_Hs01_00175445 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105794 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212596 predicted 537
2 SASI_Rn02_00212597 predicted 802
3 SASI_Rn02_00212598 predicted 963
4 SASI_Rn02_00212599 predicted 483
5 SASI_Rn02_00212600 predicted 642
6 SASI_Rn02_00212601 predicted 530
7 SASI_Rn02_00212602 predicted 654
8 SASI_Rn02_00212603 predicted 470
9 SASI_Rn02_00212604 predicted 725
10 SASI_Rn02_00212605 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030083 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138239 predicted 214
2 SASI_Mm01_00138240 predicted 223
3 SASI_Mm01_00138241 predicted 250
4 SASI_Mm01_00138242 predicted 251
5 SASI_Mm01_00138243 predicted 249
6 SASI_Mm01_00138244 predicted 247
7 SASI_Mm01_00138245 predicted 279
8 SASI_Mm01_00138246 predicted 269
9 SASI_Mm01_00138247 predicted 262
10 SASI_Mm01_00138248 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032356
VALIDATED
LSMD1 MISSION shRNA Bacterial Glycerol Stock
LSM domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032356.3-474s21c1
Sequence:CCGGTTAGCACGGGCTCTGGTTCTGCTCGAGCAGAACCAGAGCCCGTGCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032356.3-624s1c2
Sequence:CCGGGCGCGGTCTGAGCGCTTGTTACTCGAGTAACAAGCGCTCAGACCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_032356.3-785s21c1
Sequence:CCGGTGACCGTGACTGCAATGTCATCTCGAGATGACATTGCAGTCACGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032356.3-822s21c1
Sequence:CCGGGAGTTCCTCAAGCCGTCGGATCTCGAGATCCGACGGCTTGAGGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032356.3-719s21c1
Sequence:CCGGGCTCAACAAGACTATGCGCATCTCGAGATGCGCATAGTCTTGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032356.3-506s21c1
Sequence:CCGGCAGTCAAGCAGCAAGATGGAGCTCGAGCTCCATCTTGCTGCTTGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032356.3-719s1c1
Sequence:CCGGGCTCAACAAGACTATGCGCATCTCGAGATGCGCATAGTCTTGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032356.3-822s1c1
Sequence:CCGGGAGTTCCTCAAGCCGTCGGATCTCGAGATCCGACGGCTTGAGGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032356.3-725s1c1
Sequence:CCGGCAAGACTATGCGCATTCGCATCTCGAGATGCGAATGCGCATAGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_032356.3-785s1c1
Sequence:CCGGTGACCGTGACTGCAATGTCATCTCGAGATGACATTGCAGTCACGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032356
VALIDATED
LSMD1 MISSION shRNA shRNA Plasmid DNA
LSM domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032356.3-474s21c1
Sequence:CCGGTTAGCACGGGCTCTGGTTCTGCTCGAGCAGAACCAGAGCCCGTGCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032356.3-624s1c2
Sequence:CCGGGCGCGGTCTGAGCGCTTGTTACTCGAGTAACAAGCGCTCAGACCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_032356.3-785s21c1
Sequence:CCGGTGACCGTGACTGCAATGTCATCTCGAGATGACATTGCAGTCACGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032356.3-822s21c1
Sequence:CCGGGAGTTCCTCAAGCCGTCGGATCTCGAGATCCGACGGCTTGAGGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032356.3-719s21c1
Sequence:CCGGGCTCAACAAGACTATGCGCATCTCGAGATGCGCATAGTCTTGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032356.3-506s21c1
Sequence:CCGGCAGTCAAGCAGCAAGATGGAGCTCGAGCTCCATCTTGCTGCTTGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032356.3-719s1c1
Sequence:CCGGGCTCAACAAGACTATGCGCATCTCGAGATGCGCATAGTCTTGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032356.3-822s1c1
Sequence:CCGGGAGTTCCTCAAGCCGTCGGATCTCGAGATCCGACGGCTTGAGGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032356.3-725s1c1
Sequence:CCGGCAAGACTATGCGCATTCGCATCTCGAGATGCGAATGCGCATAGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_032356.3-785s1c1
Sequence:CCGGTGACCGTGACTGCAATGTCATCTCGAGATGACATTGCAGTCACGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032356
VALIDATED
LSMD1 MISSION shRNA Lentiviral Transduction Particles
LSM domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032356.3-474s21c1
Sequence:CCGGTTAGCACGGGCTCTGGTTCTGCTCGAGCAGAACCAGAGCCCGTGCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032356.3-624s1c2
Sequence:CCGGGCGCGGTCTGAGCGCTTGTTACTCGAGTAACAAGCGCTCAGACCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_032356.3-785s21c1
Sequence:CCGGTGACCGTGACTGCAATGTCATCTCGAGATGACATTGCAGTCACGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032356.3-822s21c1
Sequence:CCGGGAGTTCCTCAAGCCGTCGGATCTCGAGATCCGACGGCTTGAGGAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032356.3-719s21c1
Sequence:CCGGGCTCAACAAGACTATGCGCATCTCGAGATGCGCATAGTCTTGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032356.3-506s21c1
Sequence:CCGGCAGTCAAGCAGCAAGATGGAGCTCGAGCTCCATCTTGCTGCTTGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032356.3-719s1c1
Sequence:CCGGGCTCAACAAGACTATGCGCATCTCGAGATGCGCATAGTCTTGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032356.3-822s1c1
Sequence:CCGGGAGTTCCTCAAGCCGTCGGATCTCGAGATCCGACGGCTTGAGGAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032356.3-725s1c1
Sequence:CCGGCAAGACTATGCGCATTCGCATCTCGAGATGCGAATGCGCATAGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_032356.3-785s1c1
Sequence:CCGGTGACCGTGACTGCAATGTCATCTCGAGATGACATTGCAGTCACGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030083
LSMD1 MISSION shRNA Bacterial Glycerol Stock
LSM domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030083.1-246s1c1
Sequence:CCGGGCTCAACAAGACCATGCGTATCTCGAGATACGCATGGTCTTGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030083.1-312s1c1
Sequence:CCGGTGATCGCGACTGTAATGTCATCTCGAGATGACATTACAGTCGCGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030083.1-231s1c1
Sequence:CCGGGCAACTAGAGGCATTGCTCAACTCGAGTTGAGCAATGCCTCTAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030083.1-263s1c1
Sequence:CCGGGTATCCGTATGACAGATGGAACTCGAGTTCCATCTGTCATACGGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030083.1-354s1c1
Sequence:CCGGCCTCAAGCCTTCTGATTCATTCTCGAGAATGAATCAGAAGGCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030083
LSMD1 MISSION shRNA shRNA Plasmid DNA
LSM domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030083.1-246s1c1
Sequence:CCGGGCTCAACAAGACCATGCGTATCTCGAGATACGCATGGTCTTGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030083.1-312s1c1
Sequence:CCGGTGATCGCGACTGTAATGTCATCTCGAGATGACATTACAGTCGCGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030083.1-231s1c1
Sequence:CCGGGCAACTAGAGGCATTGCTCAACTCGAGTTGAGCAATGCCTCTAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030083.1-263s1c1
Sequence:CCGGGTATCCGTATGACAGATGGAACTCGAGTTCCATCTGTCATACGGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030083.1-354s1c1
Sequence:CCGGCCTCAAGCCTTCTGATTCATTCTCGAGAATGAATCAGAAGGCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030083
LSMD1 MISSION shRNA Lentiviral Transduction Particles
LSM domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030083.1-246s1c1
Sequence:CCGGGCTCAACAAGACCATGCGTATCTCGAGATACGCATGGTCTTGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030083.1-312s1c1
Sequence:CCGGTGATCGCGACTGTAATGTCATCTCGAGATGACATTACAGTCGCGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030083.1-231s1c1
Sequence:CCGGGCAACTAGAGGCATTGCTCAACTCGAGTTGAGCAATGCCTCTAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030083.1-263s1c1
Sequence:CCGGGTATCCGTATGACAGATGGAACTCGAGTTCCATCTGTCATACGGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030083.1-354s1c1
Sequence:CCGGCCTCAAGCCTTCTGATTCATTCTCGAGAATGAATCAGAAGGCTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)