EMAIL THIS PAGE TO A FRIEND

LSMEM1

leucine-rich single-pass membrane protein 1

155 Gene Product Result for
Synonyms: C7orf53
UniProtKB ID: Q8N8F7, Q49AR6
Gene ID:
Mouse(380755) leucine-rich single-pass membrane protein 1
Rat(680810) leucine-rich single-pass membrane protein 1
domestic guinea pig(100727218) leucine-rich single-pass membrane protein 1
naked mole-rat(101719438) leucine-rich single-pass membrane protein 1
dog(611967) leucine-rich single-pass membrane protein 1
cow(613798) leucine-rich single-pass membrane protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182597 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033437 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033437 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033437 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182597 Rosetta Predictions human pricing
XM_001058983 Rosetta Predictions rat pricing
NM_001033437 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148192 predicted 845
2 SASI_Hs01_00148193 predicted 684
3 SASI_Hs01_00148194 predicted 800
4 SASI_Hs01_00148195 predicted 621
5 SASI_Hs02_00370737 predicted 1134
6 SASI_Hs01_00148197 predicted 671
7 SASI_Hs01_00148199 predicted 520
8 SASI_Hs01_00148200 predicted 616
9 SASI_Hs01_00148201 predicted 724
10 SASI_Hs02_00370738 predicted 707
11 SASI_Hs01_00148196 predicted 700
12 SASI_Hs01_00148198 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291506 predicted 265
2 SASI_Rn02_00291507 predicted 214
3 SASI_Rn02_00291508 predicted 213
4 SASI_Rn02_00291509 predicted 224
5 SASI_Rn02_00291510 predicted 273
6 SASI_Rn02_00291511 predicted 216
7 SASI_Rn02_00291512 predicted 221
8 SASI_Rn02_00291513 predicted 230
9 SASI_Rn02_00291514 predicted 228
10 SASI_Rn02_00291515 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162127 predicted 565
2 SASI_Mm01_00162128 predicted 423
3 SASI_Mm01_00162129 predicted 743
4 SASI_Mm01_00162130 predicted 593
5 SASI_Mm02_00288755 predicted 414
6 SASI_Mm01_00162131 predicted 581
7 SASI_Mm02_00288756 predicted 666
8 SASI_Mm01_00162132 predicted 638
9 SASI_Mm02_00288757 predicted 614
10 SASI_Mm02_00288758 predicted 809
11 SASI_Mm01_00162125 predicted 222
12 SASI_Mm01_00162126 predicted 757
13 SASI_Mm01_00162133 predicted 954
14 SASI_Mm01_00162134 predicted 229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182597
LSMEM1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich single-pass membrane protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182597.1-634s1c1
Sequence:CCGGGATGATGTGTCAAGAAGACTACTCGAGTAGTCTTCTTGACACATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182597.1-1528s1c1
Sequence:CCGGGCTGATTGATTTGGAAGAAATCTCGAGATTTCTTCCAAATCAATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182597.2-1111s21c1
Sequence:CCGGCTCATGCACCTTTACAGATATCTCGAGATATCTGTAAAGGTGCATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182597.2-580s21c1
Sequence:CCGGTCGTGATATTTCTAATAGTTCCTCGAGGAACTATTAGAAATATCACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182597.1-555s1c1
Sequence:CCGGGCTGCTAATTGTGCTGATTGTCTCGAGACAATCAGCACAATTAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182597.1-687s1c1
Sequence:CCGGGAGAATCAATAACATGATCGTCTCGAGACGATCATGTTATTGATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182597.1-421s1c1
Sequence:CCGGGTGGATTCCATAAATGACTTACTCGAGTAAGTCATTTATGGAATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182597.2-375s21c1
Sequence:CCGGGGCATTCAGGAAGATGGAAAGCTCGAGCTTTCCATCTTCCTGAATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182597
LSMEM1 MISSION shRNA shRNA Plasmid DNA
leucine-rich single-pass membrane protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182597.1-634s1c1
Sequence:CCGGGATGATGTGTCAAGAAGACTACTCGAGTAGTCTTCTTGACACATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182597.1-1528s1c1
Sequence:CCGGGCTGATTGATTTGGAAGAAATCTCGAGATTTCTTCCAAATCAATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182597.2-1111s21c1
Sequence:CCGGCTCATGCACCTTTACAGATATCTCGAGATATCTGTAAAGGTGCATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182597.2-580s21c1
Sequence:CCGGTCGTGATATTTCTAATAGTTCCTCGAGGAACTATTAGAAATATCACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182597.1-555s1c1
Sequence:CCGGGCTGCTAATTGTGCTGATTGTCTCGAGACAATCAGCACAATTAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182597.1-687s1c1
Sequence:CCGGGAGAATCAATAACATGATCGTCTCGAGACGATCATGTTATTGATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182597.1-421s1c1
Sequence:CCGGGTGGATTCCATAAATGACTTACTCGAGTAAGTCATTTATGGAATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182597.2-375s21c1
Sequence:CCGGGGCATTCAGGAAGATGGAAAGCTCGAGCTTTCCATCTTCCTGAATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182597
LSMEM1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich single-pass membrane protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182597.1-634s1c1
Sequence:CCGGGATGATGTGTCAAGAAGACTACTCGAGTAGTCTTCTTGACACATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182597.1-1528s1c1
Sequence:CCGGGCTGATTGATTTGGAAGAAATCTCGAGATTTCTTCCAAATCAATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182597.2-1111s21c1
Sequence:CCGGCTCATGCACCTTTACAGATATCTCGAGATATCTGTAAAGGTGCATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182597.2-580s21c1
Sequence:CCGGTCGTGATATTTCTAATAGTTCCTCGAGGAACTATTAGAAATATCACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182597.1-555s1c1
Sequence:CCGGGCTGCTAATTGTGCTGATTGTCTCGAGACAATCAGCACAATTAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182597.1-687s1c1
Sequence:CCGGGAGAATCAATAACATGATCGTCTCGAGACGATCATGTTATTGATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182597.1-421s1c1
Sequence:CCGGGTGGATTCCATAAATGACTTACTCGAGTAAGTCATTTATGGAATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182597.2-375s21c1
Sequence:CCGGGGCATTCAGGAAGATGGAAAGCTCGAGCTTTCCATCTTCCTGAATGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033437
LSMEM1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich single-pass membrane protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033437.2-581s21c1
Sequence:CCGGGTGCACATACTATCCATTATACTCGAGTATAATGGATAGTATGTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033437.2-484s21c1
Sequence:CCGGGACTCTGAACAGAACTGAAAGCTCGAGCTTTCAGTTCTGTTCAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033437.2-344s21c1
Sequence:CCGGTGGTCTTCTTCGCCATCTTTCCTCGAGGAAAGATGGCGAAGAAGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033437.2-172s21c1
Sequence:CCGGTACGTTGTGGATTCCATAAATCTCGAGATTTATGGAATCCACAACGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033437.2-219s21c1
Sequence:CCGGGATGGAATCACAACATCTATTCTCGAGAATAGATGTTGTGATTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033437
LSMEM1 MISSION shRNA shRNA Plasmid DNA
leucine-rich single-pass membrane protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033437.2-581s21c1
Sequence:CCGGGTGCACATACTATCCATTATACTCGAGTATAATGGATAGTATGTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033437.2-484s21c1
Sequence:CCGGGACTCTGAACAGAACTGAAAGCTCGAGCTTTCAGTTCTGTTCAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033437.2-344s21c1
Sequence:CCGGTGGTCTTCTTCGCCATCTTTCCTCGAGGAAAGATGGCGAAGAAGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033437.2-172s21c1
Sequence:CCGGTACGTTGTGGATTCCATAAATCTCGAGATTTATGGAATCCACAACGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033437.2-219s21c1
Sequence:CCGGGATGGAATCACAACATCTATTCTCGAGAATAGATGTTGTGATTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033437
LSMEM1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich single-pass membrane protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033437.2-581s21c1
Sequence:CCGGGTGCACATACTATCCATTATACTCGAGTATAATGGATAGTATGTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033437.2-484s21c1
Sequence:CCGGGACTCTGAACAGAACTGAAAGCTCGAGCTTTCAGTTCTGTTCAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033437.2-344s21c1
Sequence:CCGGTGGTCTTCTTCGCCATCTTTCCTCGAGGAAAGATGGCGAAGAAGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033437.2-172s21c1
Sequence:CCGGTACGTTGTGGATTCCATAAATCTCGAGATTTATGGAATCCACAACGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033437.2-219s21c1
Sequence:CCGGGATGGAATCACAACATCTATTCTCGAGAATAGATGTTGTGATTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)