EMAIL THIS PAGE TO A FRIEND

LSMEM2

leucine-rich single-pass membrane protein 2

86 Gene Product Result for
Synonyms: C3orf45
UniProtKB ID: Q8N112
Gene ID:
Mouse(434436) leucine-rich single-pass membrane protein 2
Rat(689621) leucine-rich single-pass membrane protein 2
dog(476616) leucine-rich single-pass membrane protein 2
cow(616532) leucine-rich single-pass membrane protein 2
naked mole-rat(101711938) leucine-rich single-pass membrane protein 2
domestic guinea pig(100733257) leucine-rich single-pass membrane protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153215 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_486255 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_486255 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_486255 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153215 Rosetta Predictions human pricing
XM_001071401 Rosetta Predictions rat pricing
NM_001081244 Rosetta Predictions mouse pricing
XM_486255 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110849 predicted 958
2 SASI_Hs01_00110850 predicted 877
3 SASI_Hs01_00110851 predicted 970
4 SASI_Hs01_00110852 predicted 214
5 SASI_Hs01_00110853 predicted 237
6 SASI_Hs01_00110854 predicted 234
7 SASI_Hs01_00110855 predicted 483
8 SASI_Hs01_00110856 predicted 589
9 SASI_Hs01_00110858 predicted 44
10 SASI_Hs02_00367075 predicted 643
11 SASI_Hs01_00110857 predicted 137
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334990 predicted 286
2 SASI_Rn02_00334991 predicted 348
3 SASI_Rn02_00334992 predicted 290
4 SASI_Rn02_00334993 predicted 65
5 SASI_Rn02_00334994 predicted 93
6 SASI_Rn02_00334995 predicted 321
7 SASI_Rn02_00334996 predicted 132
8 SASI_Rn02_00334997 predicted 405
9 SASI_Rn02_00334998 predicted 184
10 SASI_Rn02_00334999 predicted 6
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296587 predicted 749
2 SASI_Mm02_00296588 predicted 509
3 SASI_Mm02_00296589 predicted 412
4 SASI_Mm02_00296590 predicted 733
5 SASI_Mm02_00296591 predicted 233
6 SASI_Mm02_00296592 predicted 665
7 SASI_Mm02_00296593 predicted 501
8 SASI_Mm02_00296594 predicted 722
9 SASI_Mm02_00296595 predicted 629
10 SASI_Mm02_00296596 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486255 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231745 predicted 764
2 SASI_Mm01_00231746 predicted 733
3 SASI_Mm01_00231747 predicted 669
4 SASI_Mm01_00231748 predicted 789
5 SASI_Mm01_00231749 predicted 676
6 SASI_Mm01_00231750 predicted 737
7 SASI_Mm01_00231751 predicted 731
8 SASI_Mm01_00231752 predicted 631
9 SASI_Mm01_00231753 predicted 779
10 SASI_Mm01_00231754 predicted 782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153215
LSMEM2 MISSION shRNA Bacterial Glycerol Stock
leucine-rich single-pass membrane protein 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166373    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-1263s1c1
Sequence:CCGGCCCTGAGGAAGGCACATATTTCTCGAGAAATATGTGCCTTCCTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-817s1c1
Sequence:CCGGGATGGCAGGTTCTGAAGTCTACTCGAGTAGACTTCAGAACCTGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165705    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-850s1c1
Sequence:CCGGCCCATAGCAATCACCCAAACTCTCGAGAGTTTGGGTGATTGCTATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153215.1-436s1c1
Sequence:CCGGCAGGAGGAGACACTACTCAAACTCGAGTTTGAGTAGTGTCTCCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153215.1-444s1c1
Sequence:CCGGGACACTACTCAAACTCCGCTTCTCGAGAAGCGGAGTTTGAGTAGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-608s1c1
Sequence:CCGGGCTGCCACATCTACACTATTTCTCGAGAAATAGTGTAGATGTGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163318    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-1218s1c1
Sequence:CCGGGAGAAAGGAAAGGAAGGGAAACTCGAGTTTCCCTTCCTTTCCTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161371    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-1067s1c1
Sequence:CCGGGCTGACCGTTCTGTTTAATTACTCGAGTAATTAAACAGAACGGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162371    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-621s1c1
Sequence:CCGGCACTATTTCCTTGGTGAGATTCTCGAGAATCTCACCAAGGAAATAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-821s1c1
Sequence:CCGGGCAGGTTCTGAAGTCTAGAAACTCGAGTTTCTAGACTTCAGAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153215.1-439s1c1
Sequence:CCGGGAGGAGACACTACTCAAACTCCTCGAGGAGTTTGAGTAGTGTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153215
LSMEM2 MISSION shRNA shRNA Plasmid DNA
leucine-rich single-pass membrane protein 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166373    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-1263s1c1
Sequence:CCGGCCCTGAGGAAGGCACATATTTCTCGAGAAATATGTGCCTTCCTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-817s1c1
Sequence:CCGGGATGGCAGGTTCTGAAGTCTACTCGAGTAGACTTCAGAACCTGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165705    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-850s1c1
Sequence:CCGGCCCATAGCAATCACCCAAACTCTCGAGAGTTTGGGTGATTGCTATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153215.1-436s1c1
Sequence:CCGGCAGGAGGAGACACTACTCAAACTCGAGTTTGAGTAGTGTCTCCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153215.1-444s1c1
Sequence:CCGGGACACTACTCAAACTCCGCTTCTCGAGAAGCGGAGTTTGAGTAGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-608s1c1
Sequence:CCGGGCTGCCACATCTACACTATTTCTCGAGAAATAGTGTAGATGTGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163318    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-1218s1c1
Sequence:CCGGGAGAAAGGAAAGGAAGGGAAACTCGAGTTTCCCTTCCTTTCCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161371    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-1067s1c1
Sequence:CCGGGCTGACCGTTCTGTTTAATTACTCGAGTAATTAAACAGAACGGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162371    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-621s1c1
Sequence:CCGGCACTATTTCCTTGGTGAGATTCTCGAGAATCTCACCAAGGAAATAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-821s1c1
Sequence:CCGGGCAGGTTCTGAAGTCTAGAAACTCGAGTTTCTAGACTTCAGAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153215.1-439s1c1
Sequence:CCGGGAGGAGACACTACTCAAACTCCTCGAGGAGTTTGAGTAGTGTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153215
LSMEM2 MISSION shRNA Lentiviral Transduction Particles
leucine-rich single-pass membrane protein 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166373    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-1263s1c1
Sequence:CCGGCCCTGAGGAAGGCACATATTTCTCGAGAAATATGTGCCTTCCTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-817s1c1
Sequence:CCGGGATGGCAGGTTCTGAAGTCTACTCGAGTAGACTTCAGAACCTGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165705    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-850s1c1
Sequence:CCGGCCCATAGCAATCACCCAAACTCTCGAGAGTTTGGGTGATTGCTATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153215.1-436s1c1
Sequence:CCGGCAGGAGGAGACACTACTCAAACTCGAGTTTGAGTAGTGTCTCCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153215.1-444s1c1
Sequence:CCGGGACACTACTCAAACTCCGCTTCTCGAGAAGCGGAGTTTGAGTAGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-608s1c1
Sequence:CCGGGCTGCCACATCTACACTATTTCTCGAGAAATAGTGTAGATGTGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163318    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-1218s1c1
Sequence:CCGGGAGAAAGGAAAGGAAGGGAAACTCGAGTTTCCCTTCCTTTCCTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161371    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-1067s1c1
Sequence:CCGGGCTGACCGTTCTGTTTAATTACTCGAGTAATTAAACAGAACGGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162371    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-621s1c1
Sequence:CCGGCACTATTTCCTTGGTGAGATTCTCGAGAATCTCACCAAGGAAATAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153215.1-821s1c1
Sequence:CCGGGCAGGTTCTGAAGTCTAGAAACTCGAGTTTCTAGACTTCAGAACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153215.1-439s1c1
Sequence:CCGGGAGGAGACACTACTCAAACTCCTCGAGGAGTTTGAGTAGTGTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_486255
LSMEM2 MISSION shRNA Bacterial Glycerol Stock
leucine-rich single-pass membrane protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486255.1-240s1c1
Sequence:CCGGGAGGAGCTTCTGGGTGTCTTACTCGAGTAAGACACCCAGAAGCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486255.1-94s1c1
Sequence:CCGGTGTTGCCAATGCAGAACCAGACTCGAGTCTGGTTCTGCATTGGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486255.1-164s1c1
Sequence:CCGGCCGAGTGGAGTCCATCAGTGACTCGAGTCACTGATGGACTCCACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486255.1-98s1c1
Sequence:CCGGGCCAATGCAGAACCAGAGGAACTCGAGTTCCTCTGGTTCTGCATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486255.1-168s1c1
Sequence:CCGGGTGGAGTCCATCAGTGACCTACTCGAGTAGGTCACTGATGGACTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_486255
LSMEM2 MISSION shRNA shRNA Plasmid DNA
leucine-rich single-pass membrane protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486255.1-240s1c1
Sequence:CCGGGAGGAGCTTCTGGGTGTCTTACTCGAGTAAGACACCCAGAAGCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486255.1-94s1c1
Sequence:CCGGTGTTGCCAATGCAGAACCAGACTCGAGTCTGGTTCTGCATTGGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486255.1-164s1c1
Sequence:CCGGCCGAGTGGAGTCCATCAGTGACTCGAGTCACTGATGGACTCCACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486255.1-98s1c1
Sequence:CCGGGCCAATGCAGAACCAGAGGAACTCGAGTTCCTCTGGTTCTGCATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486255.1-168s1c1
Sequence:CCGGGTGGAGTCCATCAGTGACCTACTCGAGTAGGTCACTGATGGACTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_486255
LSMEM2 MISSION shRNA Lentiviral Transduction Particles
leucine-rich single-pass membrane protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486255.1-240s1c1
Sequence:CCGGGAGGAGCTTCTGGGTGTCTTACTCGAGTAAGACACCCAGAAGCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486255.1-94s1c1
Sequence:CCGGTGTTGCCAATGCAGAACCAGACTCGAGTCTGGTTCTGCATTGGCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486255.1-164s1c1
Sequence:CCGGCCGAGTGGAGTCCATCAGTGACTCGAGTCACTGATGGACTCCACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486255.1-98s1c1
Sequence:CCGGGCCAATGCAGAACCAGAGGAACTCGAGTTCCTCTGGTTCTGCATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486255.1-168s1c1
Sequence:CCGGGTGGAGTCCATCAGTGACCTACTCGAGTAGGTCACTGATGGACTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)