EMAIL THIS PAGE TO A FRIEND

LSP1

lymphocyte-specific protein 1

88 Gene Product Result for
Synonyms: WP34 pp52
Gene ID:
Human(4046) Summary: This gene encodes an intracellular F-actin binding protein. The protein is expressed in lymphocytes, neutrophils, macrophages, and endothelium and may regulate neutrophil motility, adhesion to fibrinogen matrix proteins, and transendothelial migration. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(16985) lymphocyte specific 1
Rat(361680) lymphocyte-specific protein 1
Thale Cress(833534) translation initiation factor 4E-2
cow(508832) lymphocyte-specific protein 1
domestic cat(101094133) lymphocyte-specific protein 1
dog(611553) lymphocyte-specific protein 1
chicken(374254) lymphocyte-specific protein 1
domestic guinea pig(100722250) lymphocyte-specific protein 1
naked mole-rat(101718008) lymphocyte-specific protein 1
sheep(101120878) lymphocyte-specific protein 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002339 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045611 MISSION® esiRNA esiRNA human LSP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013253 Rosetta Predictions human pricing
NM_001013254 Rosetta Predictions human pricing
NM_001013255 Rosetta Predictions human pricing
NM_002339 Rosetta Predictions human pricing
NM_001025420 Rosetta Predictions rat pricing
NM_019391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190966 predicted 889
2 SASI_Hs01_00190967 predicted 871
3 SASI_Hs01_00190968 predicted 922
4 SASI_Hs01_00190969 predicted 850
5 SASI_Hs01_00190970 predicted 873
6 SASI_Hs01_00190971 predicted 864
7 SASI_Hs01_00190972 predicted 933
8 SASI_Hs01_00190975 predicted 1545
9 SASI_Hs02_00306331 predicted 1189
10 SASI_Hs02_00306332 predicted 880
11 SASI_Hs01_00190973 predicted 1203
12 SASI_Hs01_00190974 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082164 predicted 1123
2 SASI_Hs01_00082165 predicted 1105
3 SASI_Hs01_00082166 predicted 1157
4 SASI_Hs01_00082167 predicted 1080
5 SASI_Hs01_00082168 predicted 1095
6 SASI_Hs01_00082169 predicted 1100
7 SASI_Hs01_00082170 predicted 1164
8 SASI_Hs01_00082173 predicted 1781
9 SASI_Hs02_00306333 predicted 1424
10 SASI_Hs02_00306334 predicted 1114
11 SASI_Hs01_00082171 predicted 1436
12 SASI_Hs01_00082172 predicted 1655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096394 predicted 625
2 SASI_Hs01_00096395 predicted 611
3 SASI_Hs01_00096396 predicted 655
4 SASI_Hs01_00096397 predicted 593
5 SASI_Hs01_00096398 predicted 605
6 SASI_Hs01_00096399 predicted 607
7 SASI_Hs01_00096400 predicted 673
8 SASI_Hs01_00096403 predicted 1286
9 SASI_Hs02_00306335 predicted 925
10 SASI_Hs02_00306336 predicted 611
11 SASI_Hs01_00096401 predicted 934
12 SASI_Hs01_00096402 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211562 predicted 802
2 SASI_Hs01_00211563 predicted 787
3 SASI_Hs01_00211564 predicted 834
4 SASI_Hs01_00211565 predicted 763
5 SASI_Hs01_00211566 predicted 778
6 SASI_Hs01_00211567 predicted 780
7 SASI_Hs01_00211568 predicted 849
8 SASI_Hs01_00211571 predicted 1461
9 SASI_Hs02_00333658 predicted 1108
10 SASI_Hs02_00333659 predicted 793
11 SASI_Hs01_00211569 predicted 1113
12 SASI_Hs01_00211570 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025420 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203158 predicted 809
2 SASI_Rn02_00203159 predicted 548
3 SASI_Rn02_00203160 predicted 606
4 SASI_Rn02_00203161 predicted 369
5 SASI_Rn02_00203162 predicted 601
6 SASI_Rn02_00203163 predicted 680
7 SASI_Rn02_00203164 predicted 332
8 SASI_Rn02_00203165 predicted 658
9 SASI_Rn02_00203166 predicted 253
10 SASI_Rn02_00203167 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196745 predicted 1440
2 SASI_Mm01_00196746 predicted 1065
3 SASI_Mm01_00196747 predicted 1376
4 SASI_Mm01_00196748 predicted 664
5 SASI_Mm02_00324313 predicted 820
6 SASI_Mm01_00196749 predicted 1449
7 SASI_Mm01_00196750 predicted 1014
8 SASI_Mm01_00196751 predicted 1072
9 SASI_Mm01_00196752 predicted 1396
10 SASI_Mm01_00196753 predicted 1362
11 SASI_Mm01_00196754 predicted 1212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002339
VALIDATED
LSP1 MISSION shRNA Bacterial Glycerol Stock
lymphocyte-specific protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_002339.2-1293s1c1
Sequence:CCGGGCTAAGAAGTTGCTTCCTGTTCTCGAGAACAGGAAGCAACTTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_002339.2-792s1c1
Sequence:CCGGACCGCTCCATAGAGAAGAGTACTCGAGTACTCTTCTCTATGGAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_002339.2-269s1c1
Sequence:CCGGGTCCACGAGCAATGCCAGCATCTCGAGATGCTGGCATTGCTCGTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002339.2-781s1c1
Sequence:CCGGCGAGTCCCTAAACCGCTCCATCTCGAGATGGAGCGGTTTAGGGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_002339.2-1111s1c1
Sequence:CCGGCCCATCTGGGAAGAGGTATAACTCGAGTTATACCTCTTCCCAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002339.2-871s21c1
Sequence:CCGGACAATACACCCAGGCCATCGACTCGAGTCGATGGCCTGGGTGTATTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002339.2-584s21c1
Sequence:CCGGGAGTTGAGTCTGAGCAAGGAGCTCGAGCTCCTTGCTCAGACTCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002339.2-841s21c1
Sequence:CCGGGCCCATCTCCAAGATTGATCACTCGAGTGATCAATCTTGGAGATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002339.2-1432s21c1
Sequence:CCGGAGCTCCGCTTCTTGTTACTTGCTCGAGCAAGTAACAAGAAGCGGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002339.2-568s21c1
Sequence:CCGGTGAAGTCCACCTGGAGGAGTTCTCGAGAACTCCTCCAGGTGGACTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002339.2-804s21c1
Sequence:CCGGAGAAGAGTAACAGTGTGAAGACTCGAGTCTTCACACTGTTACTCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002339
VALIDATED
LSP1 MISSION shRNA shRNA Plasmid DNA
lymphocyte-specific protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_002339.2-1293s1c1
Sequence:CCGGGCTAAGAAGTTGCTTCCTGTTCTCGAGAACAGGAAGCAACTTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_002339.2-792s1c1
Sequence:CCGGACCGCTCCATAGAGAAGAGTACTCGAGTACTCTTCTCTATGGAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_002339.2-269s1c1
Sequence:CCGGGTCCACGAGCAATGCCAGCATCTCGAGATGCTGGCATTGCTCGTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002339.2-781s1c1
Sequence:CCGGCGAGTCCCTAAACCGCTCCATCTCGAGATGGAGCGGTTTAGGGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_002339.2-1111s1c1
Sequence:CCGGCCCATCTGGGAAGAGGTATAACTCGAGTTATACCTCTTCCCAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002339.2-871s21c1
Sequence:CCGGACAATACACCCAGGCCATCGACTCGAGTCGATGGCCTGGGTGTATTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002339.2-584s21c1
Sequence:CCGGGAGTTGAGTCTGAGCAAGGAGCTCGAGCTCCTTGCTCAGACTCAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002339.2-841s21c1
Sequence:CCGGGCCCATCTCCAAGATTGATCACTCGAGTGATCAATCTTGGAGATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002339.2-1432s21c1
Sequence:CCGGAGCTCCGCTTCTTGTTACTTGCTCGAGCAAGTAACAAGAAGCGGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002339.2-568s21c1
Sequence:CCGGTGAAGTCCACCTGGAGGAGTTCTCGAGAACTCCTCCAGGTGGACTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002339.2-804s21c1
Sequence:CCGGAGAAGAGTAACAGTGTGAAGACTCGAGTCTTCACACTGTTACTCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002339
VALIDATED
LSP1 MISSION shRNA Lentiviral Transduction Particles
lymphocyte-specific protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_002339.2-1293s1c1
Sequence:CCGGGCTAAGAAGTTGCTTCCTGTTCTCGAGAACAGGAAGCAACTTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_002339.2-792s1c1
Sequence:CCGGACCGCTCCATAGAGAAGAGTACTCGAGTACTCTTCTCTATGGAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_002339.2-269s1c1
Sequence:CCGGGTCCACGAGCAATGCCAGCATCTCGAGATGCTGGCATTGCTCGTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002339.2-781s1c1
Sequence:CCGGCGAGTCCCTAAACCGCTCCATCTCGAGATGGAGCGGTTTAGGGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_002339.2-1111s1c1
Sequence:CCGGCCCATCTGGGAAGAGGTATAACTCGAGTTATACCTCTTCCCAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002339.2-871s21c1
Sequence:CCGGACAATACACCCAGGCCATCGACTCGAGTCGATGGCCTGGGTGTATTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002339.2-584s21c1
Sequence:CCGGGAGTTGAGTCTGAGCAAGGAGCTCGAGCTCCTTGCTCAGACTCAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002339.2-841s21c1
Sequence:CCGGGCCCATCTCCAAGATTGATCACTCGAGTGATCAATCTTGGAGATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002339.2-1432s21c1
Sequence:CCGGAGCTCCGCTTCTTGTTACTTGCTCGAGCAAGTAACAAGAAGCGGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002339.2-568s21c1
Sequence:CCGGTGAAGTCCACCTGGAGGAGTTCTCGAGAACTCCTCCAGGTGGACTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002339.2-804s21c1
Sequence:CCGGAGAAGAGTAACAGTGTGAAGACTCGAGTCTTCACACTGTTACTCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019391
VALIDATED
LSP1 MISSION shRNA Bacterial Glycerol Stock
lymphocyte-specific protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019391.1-1492s1c1
Sequence:CCGGGCCCTGACCAAGAAATTGCTTCTCGAGAAGCAATTTCTTGGTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019391.1-1399s1c1
Sequence:CCGGCATGGGAAGTACGAGAAAGTACTCGAGTACTTTCTCGTACTTCCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019391.1-823s1c1
Sequence:CCGGGAGAGTTCTCACCAAGCCAAACTCGAGTTTGGCTTGGTGAGAACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019391.1-1242s1c1
Sequence:CCGGGCAGAGTCAGTCTGCTTCTAACTCGAGTTAGAAGCAGACTGACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019391.1-1288s1c1
Sequence:CCGGGCTGGAGACATGAGCAAGAAACTCGAGTTTCTTGCTCATGTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019391.2-824s21c1
Sequence:CCGGGAGAGTTCTCACCAAGCCAAACTCGAGTTTGGCTTGGTGAGAACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019391.2-1451s21c1
Sequence:CCGGATGTTTGCATCCTGGATAGACCTCGAGGTCTATCCAGGATGCAAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019391.2-1035s21c1
Sequence:CCGGAGTCCCTGAACCGCTCCATTACTCGAGTAATGGAGCGGTTCAGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019391.2-1400s21c1
Sequence:CCGGCATGGGAAGTACGAGAAAGTACTCGAGTACTTTCTCGTACTTCCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019391.2-1110s21c1
Sequence:CCGGATGAACGCCTGCAGCAGTATACTCGAGTATACTGCTGCAGGCGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019391
VALIDATED
LSP1 MISSION shRNA shRNA Plasmid DNA
lymphocyte-specific protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019391.1-1492s1c1
Sequence:CCGGGCCCTGACCAAGAAATTGCTTCTCGAGAAGCAATTTCTTGGTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019391.1-1399s1c1
Sequence:CCGGCATGGGAAGTACGAGAAAGTACTCGAGTACTTTCTCGTACTTCCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019391.1-823s1c1
Sequence:CCGGGAGAGTTCTCACCAAGCCAAACTCGAGTTTGGCTTGGTGAGAACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019391.1-1242s1c1
Sequence:CCGGGCAGAGTCAGTCTGCTTCTAACTCGAGTTAGAAGCAGACTGACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019391.1-1288s1c1
Sequence:CCGGGCTGGAGACATGAGCAAGAAACTCGAGTTTCTTGCTCATGTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019391.2-824s21c1
Sequence:CCGGGAGAGTTCTCACCAAGCCAAACTCGAGTTTGGCTTGGTGAGAACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019391.2-1451s21c1
Sequence:CCGGATGTTTGCATCCTGGATAGACCTCGAGGTCTATCCAGGATGCAAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019391.2-1035s21c1
Sequence:CCGGAGTCCCTGAACCGCTCCATTACTCGAGTAATGGAGCGGTTCAGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019391.2-1400s21c1
Sequence:CCGGCATGGGAAGTACGAGAAAGTACTCGAGTACTTTCTCGTACTTCCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019391.2-1110s21c1
Sequence:CCGGATGAACGCCTGCAGCAGTATACTCGAGTATACTGCTGCAGGCGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019391
VALIDATED
LSP1 MISSION shRNA Lentiviral Transduction Particles
lymphocyte-specific protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019391.1-1492s1c1
Sequence:CCGGGCCCTGACCAAGAAATTGCTTCTCGAGAAGCAATTTCTTGGTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019391.1-1399s1c1
Sequence:CCGGCATGGGAAGTACGAGAAAGTACTCGAGTACTTTCTCGTACTTCCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019391.1-823s1c1
Sequence:CCGGGAGAGTTCTCACCAAGCCAAACTCGAGTTTGGCTTGGTGAGAACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019391.1-1242s1c1
Sequence:CCGGGCAGAGTCAGTCTGCTTCTAACTCGAGTTAGAAGCAGACTGACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019391.1-1288s1c1
Sequence:CCGGGCTGGAGACATGAGCAAGAAACTCGAGTTTCTTGCTCATGTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019391.2-824s21c1
Sequence:CCGGGAGAGTTCTCACCAAGCCAAACTCGAGTTTGGCTTGGTGAGAACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019391.2-1451s21c1
Sequence:CCGGATGTTTGCATCCTGGATAGACCTCGAGGTCTATCCAGGATGCAAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019391.2-1035s21c1
Sequence:CCGGAGTCCCTGAACCGCTCCATTACTCGAGTAATGGAGCGGTTCAGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019391.2-1400s21c1
Sequence:CCGGCATGGGAAGTACGAGAAAGTACTCGAGTACTTTCTCGTACTTCCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019391.2-1110s21c1
Sequence:CCGGATGAACGCCTGCAGCAGTATACTCGAGTATACTGCTGCAGGCGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)