EMAIL THIS PAGE TO A FRIEND

LSS

lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)

60 Gene Product Result for
Synonyms: OSC
Gene ID:
Human(4047) Summary: The protein encoded by this gene catalyzes the conversion of (S)-2,3 oxidosqualene to lanosterol. The encoded protein is a member of the terpene cyclase/mutase family and catalyzes the first step in the biosynthesis of cholesterol, steroid hormones, and vitamin D. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2009]
Mouse(16987) lanosterol synthase
Rat(81681) lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)
sheep(101106995) lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)
domestic guinea pig(100728014) lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)
naked mole-rat(101713900) lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)
Zebrafish(795400) lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)
cow(615906) lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)
Horse(100055292) lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)
domestic cat(101080651) lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)
dog(491611) lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)
chicken(100310178) Egg shell lightness
chicken(100309640) Egg shell lightness
chicken(424037) lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146006 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146006 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146006 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001438 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133141 MISSION® esiRNA esiRNA human LSS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001438 Rosetta Predictions human pricing
NM_002340 Rosetta Predictions human pricing
NM_031049 Rosetta Predictions rat pricing
NM_146006 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164086 predicted 1647
2 SASI_Hs01_00164087 predicted 499
3 SASI_Hs01_00164088 predicted 1294
4 SASI_Hs01_00164089 predicted 1059
5 SASI_Hs01_00164090 predicted 477
6 SASI_Hs01_00164091 predicted 495
7 SASI_Hs01_00164092 predicted 1463
8 SASI_Hs02_00303775 predicted 678
9 SASI_Hs01_00164093 predicted 1973
10 SASI_Hs01_00164095 predicted 394
11 SASI_Hs01_00164094 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151989 predicted 1641
2 SASI_Hs01_00151990 predicted 496
3 SASI_Hs01_00151991 predicted 1299
4 SASI_Hs01_00151992 predicted 1055
5 SASI_Hs01_00151993 predicted 482
6 SASI_Hs01_00151994 predicted 491
7 SASI_Hs01_00151995 predicted 1461
8 SASI_Hs02_00333660 predicted 674
9 SASI_Hs01_00151996 predicted 1972
10 SASI_Hs01_00151998 predicted 400
11 SASI_Hs01_00151997 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031049 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060560 predicted 1072
2 SASI_Rn02_00264274 predicted 943
3 SASI_Rn01_00060561 predicted 1606
4 SASI_Rn01_00060562 predicted 1525
5 SASI_Rn01_00060563 predicted 210
6 SASI_Rn01_00060564 predicted 2060
7 SASI_Rn01_00060565 predicted 1630
8 SASI_Rn01_00060566 predicted 1614
9 SASI_Rn01_00060567 predicted 1323
10 SASI_Rn01_00060568 predicted 1828
11 SASI_Rn01_00060569 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146006 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175375 predicted 937
2 SASI_Mm01_00175376 predicted 262
3 SASI_Mm01_00175377 predicted 210
4 SASI_Mm01_00175378 predicted 1599
5 SASI_Mm01_00175379 predicted 1610
6 SASI_Mm01_00175380 predicted 1630
7 SASI_Mm01_00175381 predicted 1649
8 SASI_Mm01_00175382 predicted 360
9 SASI_Mm01_00175383 predicted 480
10 SASI_Mm01_00175384 predicted 1638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146006
VALIDATED
LSS MISSION shRNA Bacterial Glycerol Stock
lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146006.1-1045s1c1
Sequence:CCGGCCCGATCTCAAAGACCATCAACTCGAGTTGATGGTCTTTGAGATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146006.1-2196s1c1
Sequence:CCGGCCAACCTGTATCCTGACAATACTCGAGTATTGTCAGGATACAGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146006.1-515s1c1
Sequence:CCGGGCTCTCAGAATCCTGGGTATTCTCGAGAATACCCAGGATTCTGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146006.1-1655s1c1
Sequence:CCGGGCACTGAAGCATTTCCATGAACTCGAGTTCATGGAAATGCTTCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146006.1-2414s1c1
Sequence:CCGGGCGCTTAAAGTTCTTGGACTACTCGAGTAGTCCAAGAACTTTAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146006.1-515s21c1
Sequence:CCGGGCTCTCAGAATCCTGGGTATTCTCGAGAATACCCAGGATTCTGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146006.1-1655s21c1
Sequence:CCGGGCACTGAAGCATTTCCATGAACTCGAGTTCATGGAAATGCTTCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146006.1-2196s21c1
Sequence:CCGGCCAACCTGTATCCTGACAATACTCGAGTATTGTCAGGATACAGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146006.1-2414s21c1
Sequence:CCGGGCGCTTAAAGTTCTTGGACTACTCGAGTAGTCCAAGAACTTTAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146006.1-1045s21c1
Sequence:CCGGCCCGATCTCAAAGACCATCAACTCGAGTTGATGGTCTTTGAGATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146006
VALIDATED
LSS MISSION shRNA shRNA Plasmid DNA
lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146006.1-1045s1c1
Sequence:CCGGCCCGATCTCAAAGACCATCAACTCGAGTTGATGGTCTTTGAGATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146006.1-2196s1c1
Sequence:CCGGCCAACCTGTATCCTGACAATACTCGAGTATTGTCAGGATACAGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146006.1-515s1c1
Sequence:CCGGGCTCTCAGAATCCTGGGTATTCTCGAGAATACCCAGGATTCTGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146006.1-1655s1c1
Sequence:CCGGGCACTGAAGCATTTCCATGAACTCGAGTTCATGGAAATGCTTCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146006.1-2414s1c1
Sequence:CCGGGCGCTTAAAGTTCTTGGACTACTCGAGTAGTCCAAGAACTTTAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146006.1-515s21c1
Sequence:CCGGGCTCTCAGAATCCTGGGTATTCTCGAGAATACCCAGGATTCTGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146006.1-1655s21c1
Sequence:CCGGGCACTGAAGCATTTCCATGAACTCGAGTTCATGGAAATGCTTCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146006.1-2196s21c1
Sequence:CCGGCCAACCTGTATCCTGACAATACTCGAGTATTGTCAGGATACAGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146006.1-2414s21c1
Sequence:CCGGGCGCTTAAAGTTCTTGGACTACTCGAGTAGTCCAAGAACTTTAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146006.1-1045s21c1
Sequence:CCGGCCCGATCTCAAAGACCATCAACTCGAGTTGATGGTCTTTGAGATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146006
VALIDATED
LSS MISSION shRNA Lentiviral Transduction Particles
lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146006.1-1045s1c1
Sequence:CCGGCCCGATCTCAAAGACCATCAACTCGAGTTGATGGTCTTTGAGATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146006.1-2196s1c1
Sequence:CCGGCCAACCTGTATCCTGACAATACTCGAGTATTGTCAGGATACAGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146006.1-515s1c1
Sequence:CCGGGCTCTCAGAATCCTGGGTATTCTCGAGAATACCCAGGATTCTGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146006.1-1655s1c1
Sequence:CCGGGCACTGAAGCATTTCCATGAACTCGAGTTCATGGAAATGCTTCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146006.1-2414s1c1
Sequence:CCGGGCGCTTAAAGTTCTTGGACTACTCGAGTAGTCCAAGAACTTTAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146006.1-515s21c1
Sequence:CCGGGCTCTCAGAATCCTGGGTATTCTCGAGAATACCCAGGATTCTGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146006.1-1655s21c1
Sequence:CCGGGCACTGAAGCATTTCCATGAACTCGAGTTCATGGAAATGCTTCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146006.1-2196s21c1
Sequence:CCGGCCAACCTGTATCCTGACAATACTCGAGTATTGTCAGGATACAGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146006.1-2414s21c1
Sequence:CCGGGCGCTTAAAGTTCTTGGACTACTCGAGTAGTCCAAGAACTTTAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146006.1-1045s21c1
Sequence:CCGGCCCGATCTCAAAGACCATCAACTCGAGTTGATGGTCTTTGAGATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001438
VALIDATED
LSS MISSION shRNA Bacterial Glycerol Stock
lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_001001438.1-2144s1c1
Sequence:CCGGCACGAGCTACAGGAACATCTTCTCGAGAAGATGTTCCTGTAGCTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_001001438.1-2348s1c1
Sequence:CCGGCCCTGCCTTCAGTCTTCTTTACTCGAGTAAAGAAGACTGAAGGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_001001438.1-980s1c1
Sequence:CCGGGCAGAAGCTGTATGAACACATCTCGAGATGTGTTCATACAGCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001001438.1-393s1c1
Sequence:CCGGGCCGGATACAGAGAAGAGATTCTCGAGAATCTCTTCTCTGTATCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001438.1-560s1c1
Sequence:CCGGCCGGAACATTCTTCACAAGAACTCGAGTTCTTGTGAAGAATGTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001438.2-254s21c1
Sequence:CCGGGACACCAAGAATTACTTTAAGCTCGAGCTTAAAGTAATTCTTGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001438.2-2487s21c1
Sequence:CCGGGTTCACAATTGGATCACAATGCTCGAGCATTGTGATCCAATTGTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001438
VALIDATED
LSS MISSION shRNA shRNA Plasmid DNA
lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_001001438.1-2144s1c1
Sequence:CCGGCACGAGCTACAGGAACATCTTCTCGAGAAGATGTTCCTGTAGCTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_001001438.1-2348s1c1
Sequence:CCGGCCCTGCCTTCAGTCTTCTTTACTCGAGTAAAGAAGACTGAAGGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_001001438.1-980s1c1
Sequence:CCGGGCAGAAGCTGTATGAACACATCTCGAGATGTGTTCATACAGCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001001438.1-393s1c1
Sequence:CCGGGCCGGATACAGAGAAGAGATTCTCGAGAATCTCTTCTCTGTATCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001438.1-560s1c1
Sequence:CCGGCCGGAACATTCTTCACAAGAACTCGAGTTCTTGTGAAGAATGTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001438.2-254s21c1
Sequence:CCGGGACACCAAGAATTACTTTAAGCTCGAGCTTAAAGTAATTCTTGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001438.2-2487s21c1
Sequence:CCGGGTTCACAATTGGATCACAATGCTCGAGCATTGTGATCCAATTGTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001438
VALIDATED
LSS MISSION shRNA Lentiviral Transduction Particles
lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_001001438.1-2144s1c1
Sequence:CCGGCACGAGCTACAGGAACATCTTCTCGAGAAGATGTTCCTGTAGCTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_001001438.1-2348s1c1
Sequence:CCGGCCCTGCCTTCAGTCTTCTTTACTCGAGTAAAGAAGACTGAAGGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_001001438.1-980s1c1
Sequence:CCGGGCAGAAGCTGTATGAACACATCTCGAGATGTGTTCATACAGCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001001438.1-393s1c1
Sequence:CCGGGCCGGATACAGAGAAGAGATTCTCGAGAATCTCTTCTCTGTATCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001438.1-560s1c1
Sequence:CCGGCCGGAACATTCTTCACAAGAACTCGAGTTCTTGTGAAGAATGTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001438.2-254s21c1
Sequence:CCGGGACACCAAGAATTACTTTAAGCTCGAGCTTAAAGTAATTCTTGGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001438.2-2487s21c1
Sequence:CCGGGTTCACAATTGGATCACAATGCTCGAGCATTGTGATCCAATTGTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)