EMAIL THIS PAGE TO A FRIEND

LST1

leukocyte specific transcript 1

90 Gene Product Result for
Synonyms: B144 D6S49E LST-1
Gene ID:
Human(7940) Summary: The protein encoded by this gene is a membrane protein that can inhibit the proliferation of lymphocytes. Expression of this gene is enhanced by lipopolysaccharide, interferon-gamma, and bacteria. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(16988) leukocyte specific transcript 1
Rat(64569) leukocyte specific transcript 1
dog(607208) leukocyte specific transcript 1
cow(100296268) leukocyte specific transcript 1
domestic cat(101099801) leukocyte specific transcript 1
naked mole-rat(101716360) leukocyte specific transcript 1
domestic guinea pig(101787132) leukocyte specific transcript 1
sheep(101122559) leukocyte specific transcript 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007161 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010734 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010734 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010734 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007161 Rosetta Predictions human pricing
NM_205837 Rosetta Predictions human pricing
NM_205838 Rosetta Predictions human pricing
NM_205839 Rosetta Predictions human pricing
NM_205840 Rosetta Predictions human pricing
NM_022634 Rosetta Predictions rat pricing
NM_010734 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055920 predicted 308
2 SASI_Hs01_00055921 predicted 452
3 SASI_Hs01_00055922 predicted 221
4 SASI_Hs01_00055923 predicted 303
5 SASI_Hs02_00343093 predicted 447
6 SASI_Hs01_00055924 predicted 452
7 SASI_Hs01_00055925 predicted 223
8 SASI_Hs01_00055926 predicted 269
9 SASI_Hs01_00055927 predicted 370
10 SASI_Hs01_00055928 predicted 232
11 SASI_Hs01_00055929 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156010 predicted 311
2 SASI_Hs02_00373465 predicted 302
3 SASI_Hs01_00156011 predicted 305
4 SASI_Hs01_00156012 predicted 309
5 SASI_Hs01_00156013 predicted 226
6 SASI_Hs01_00156014 predicted 212
7 SASI_Hs01_00156015 predicted 265
8 SASI_Hs01_00156016 predicted 320
9 SASI_Hs01_00156017 predicted 224
10 SASI_Hs01_00156018 predicted 215
11 SASI_Hs01_00156019 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230401 predicted 323
2 SASI_Hs02_00373466 predicted 314
3 SASI_Hs01_00230402 predicted 227
4 SASI_Hs01_00230403 predicted 316
5 SASI_Hs01_00230404 predicted 320
6 SASI_Hs01_00230405 predicted 230
7 SASI_Hs01_00230406 predicted 277
8 SASI_Hs01_00230407 predicted 322
9 SASI_Hs01_00230408 predicted 492
10 SASI_Hs01_00230409 predicted 494
11 SASI_Hs01_00230410 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081244 predicted 344
2 SASI_Hs02_00373467 predicted 337
3 SASI_Hs01_00081245 predicted 342
4 SASI_Hs01_00081246 predicted 345
5 SASI_Hs01_00081247 predicted 297
6 SASI_Hs01_00081248 predicted 346
7 SASI_Hs01_00081249 predicted 506
8 SASI_Hs01_00081250 predicted 512
9 SASI_Hs01_00081251 predicted 503
10 SASI_Hs01_00081252 predicted 506
11 SASI_Hs01_00081253 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173546 predicted 300
2 SASI_Hs02_00373468 predicted 295
3 SASI_Hs01_00173547 predicted 295
4 SASI_Hs01_00173548 predicted 297
5 SASI_Hs01_00173549 predicted 252
6 SASI_Hs01_00173550 predicted 304
7 SASI_Hs01_00173551 predicted 470
8 SASI_Hs01_00173552 predicted 469
9 SASI_Hs01_00173553 predicted 461
10 SASI_Hs01_00173554 predicted 465
11 SASI_Hs01_00173555 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022634 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108416 predicted 317
2 SASI_Rn01_00108417 predicted 168
3 SASI_Rn01_00108418 predicted 49
4 SASI_Rn01_00108419 predicted 48
5 SASI_Rn01_00108420 predicted 286
6 SASI_Rn01_00108421 predicted 50
7 SASI_Rn01_00108422 predicted 233
8 SASI_Rn01_00108423 predicted 59
9 SASI_Rn01_00108424 predicted 72
10 SASI_Rn01_00108425 predicted 70
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010734 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195115 predicted 80
2 SASI_Mm01_00195116 predicted 243
3 SASI_Mm01_00195117 predicted 66
4 SASI_Mm02_00319237 predicted 245
5 SASI_Mm01_00195118 predicted 74
6 SASI_Mm01_00195119 predicted 161
7 SASI_Mm01_00195120 predicted 269
8 SASI_Mm01_00195121 predicted 149
9 SASI_Mm01_00195122 predicted 226
10 SASI_Mm01_00195123 predicted 285
11 SASI_Mm01_00195124 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007161
LST1 MISSION shRNA Bacterial Glycerol Stock
leukocyte specific transcript 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007161.3-382s21c1
Sequence:CCGGCTATGCCTGCATTGCTGAGAACTCGAGTTCTCAGCAATGCAGGCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007161.3-366s21c1
Sequence:CCGGAGGATCCAAGAGCTGACTATGCTCGAGCATAGTCAGCTCTTGGATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-321s1c1
Sequence:CCGGGCTGCATCGAAGAGTAAAGAGCTCGAGCTCTTTACTCTTCGATGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-375s1c1
Sequence:CCGGCAGGAACTCCACTATGCATCTCTCGAGAGATGCATAGTGGAGTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-325s1c1
Sequence:CCGGCATCGAAGAGTAAAGAGGCTGCTCGAGCAGCCTCTTTACTCTTCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-329s1c1
Sequence:CCGGGAAGAGTAAAGAGGCTGGAGACTCGAGTCTCCAGCCTCTTTACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-465s1c1
Sequence:CCGGGAGGATCCAAGAGCTGACTATCTCGAGATAGTCAGCTCTTGGATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-486s1c1
Sequence:CCGGGCCTGCATTGCTGAGAACAAACTCGAGTTTGTTCTCAGCAATGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007161.3-374s21c1
Sequence:CCGGAGAGCTGACTATGCCTGCATTCTCGAGAATGCAGGCATAGTCAGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-324s1c1
Sequence:CCGGGCATCGAAGAGTAAAGAGGCTCTCGAGAGCCTCTTTACTCTTCGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-490s1c1
Sequence:CCGGGCATTGCTGAGAACAAACCCACTCGAGTGGGTTTGTTCTCAGCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007161
LST1 MISSION shRNA shRNA Plasmid DNA
leukocyte specific transcript 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007161.3-382s21c1
Sequence:CCGGCTATGCCTGCATTGCTGAGAACTCGAGTTCTCAGCAATGCAGGCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007161.3-366s21c1
Sequence:CCGGAGGATCCAAGAGCTGACTATGCTCGAGCATAGTCAGCTCTTGGATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-321s1c1
Sequence:CCGGGCTGCATCGAAGAGTAAAGAGCTCGAGCTCTTTACTCTTCGATGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-375s1c1
Sequence:CCGGCAGGAACTCCACTATGCATCTCTCGAGAGATGCATAGTGGAGTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-325s1c1
Sequence:CCGGCATCGAAGAGTAAAGAGGCTGCTCGAGCAGCCTCTTTACTCTTCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-329s1c1
Sequence:CCGGGAAGAGTAAAGAGGCTGGAGACTCGAGTCTCCAGCCTCTTTACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-465s1c1
Sequence:CCGGGAGGATCCAAGAGCTGACTATCTCGAGATAGTCAGCTCTTGGATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-486s1c1
Sequence:CCGGGCCTGCATTGCTGAGAACAAACTCGAGTTTGTTCTCAGCAATGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007161.3-374s21c1
Sequence:CCGGAGAGCTGACTATGCCTGCATTCTCGAGAATGCAGGCATAGTCAGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-324s1c1
Sequence:CCGGGCATCGAAGAGTAAAGAGGCTCTCGAGAGCCTCTTTACTCTTCGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-490s1c1
Sequence:CCGGGCATTGCTGAGAACAAACCCACTCGAGTGGGTTTGTTCTCAGCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007161
LST1 MISSION shRNA Lentiviral Transduction Particles
leukocyte specific transcript 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007161.3-382s21c1
Sequence:CCGGCTATGCCTGCATTGCTGAGAACTCGAGTTCTCAGCAATGCAGGCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007161.3-366s21c1
Sequence:CCGGAGGATCCAAGAGCTGACTATGCTCGAGCATAGTCAGCTCTTGGATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-321s1c1
Sequence:CCGGGCTGCATCGAAGAGTAAAGAGCTCGAGCTCTTTACTCTTCGATGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-375s1c1
Sequence:CCGGCAGGAACTCCACTATGCATCTCTCGAGAGATGCATAGTGGAGTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-325s1c1
Sequence:CCGGCATCGAAGAGTAAAGAGGCTGCTCGAGCAGCCTCTTTACTCTTCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-329s1c1
Sequence:CCGGGAAGAGTAAAGAGGCTGGAGACTCGAGTCTCCAGCCTCTTTACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-465s1c1
Sequence:CCGGGAGGATCCAAGAGCTGACTATCTCGAGATAGTCAGCTCTTGGATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-486s1c1
Sequence:CCGGGCCTGCATTGCTGAGAACAAACTCGAGTTTGTTCTCAGCAATGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007161.3-374s21c1
Sequence:CCGGAGAGCTGACTATGCCTGCATTCTCGAGAATGCAGGCATAGTCAGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-324s1c1
Sequence:CCGGGCATCGAAGAGTAAAGAGGCTCTCGAGAGCCTCTTTACTCTTCGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007161.2-490s1c1
Sequence:CCGGGCATTGCTGAGAACAAACCCACTCGAGTGGGTTTGTTCTCAGCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010734
VALIDATED
LST1 MISSION shRNA Bacterial Glycerol Stock
leukocyte specific transcript 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010734.1-173s1c1
Sequence:CCGGGTGAAGAGACTGGAAAGGAATCTCGAGATTCCTTTCCAGTCTCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010734.2-247s21c1
Sequence:CCGGTGCCAGTGTCCAGTAGTGATACTCGAGTATCACTACTGGACACTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010734.2-81s21c1
Sequence:CCGGACCAATGATTTCCTGCTAAATCTCGAGATTTAGCAGGAAATCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010734.2-125s21c1
Sequence:CCGGCCTCCTCCTGCTTGTCATCATCTCGAGATGATGACAAGCAGGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010734.2-166s21c1
Sequence:CCGGGGTTCAGTCAGAGAGTGAAGACTCGAGTCTTCACTCTCTGACTGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_010734.2-225s21c1
Sequence:CCGGCACTATGCATCTCTCCAGCAGCTCGAGCTGCTGGAGAGATGCATAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010734.1-75s1c1
Sequence:CCGGCCAATCATTTCCTGCTCTATGCTCGAGCATAGAGCAGGAAATGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010734
VALIDATED
LST1 MISSION shRNA shRNA Plasmid DNA
leukocyte specific transcript 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010734.1-173s1c1
Sequence:CCGGGTGAAGAGACTGGAAAGGAATCTCGAGATTCCTTTCCAGTCTCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010734.2-247s21c1
Sequence:CCGGTGCCAGTGTCCAGTAGTGATACTCGAGTATCACTACTGGACACTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010734.2-81s21c1
Sequence:CCGGACCAATGATTTCCTGCTAAATCTCGAGATTTAGCAGGAAATCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010734.2-125s21c1
Sequence:CCGGCCTCCTCCTGCTTGTCATCATCTCGAGATGATGACAAGCAGGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010734.2-166s21c1
Sequence:CCGGGGTTCAGTCAGAGAGTGAAGACTCGAGTCTTCACTCTCTGACTGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_010734.2-225s21c1
Sequence:CCGGCACTATGCATCTCTCCAGCAGCTCGAGCTGCTGGAGAGATGCATAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010734.1-75s1c1
Sequence:CCGGCCAATCATTTCCTGCTCTATGCTCGAGCATAGAGCAGGAAATGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010734
VALIDATED
LST1 MISSION shRNA Lentiviral Transduction Particles
leukocyte specific transcript 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010734.1-173s1c1
Sequence:CCGGGTGAAGAGACTGGAAAGGAATCTCGAGATTCCTTTCCAGTCTCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010734.2-247s21c1
Sequence:CCGGTGCCAGTGTCCAGTAGTGATACTCGAGTATCACTACTGGACACTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010734.2-81s21c1
Sequence:CCGGACCAATGATTTCCTGCTAAATCTCGAGATTTAGCAGGAAATCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010734.2-125s21c1
Sequence:CCGGCCTCCTCCTGCTTGTCATCATCTCGAGATGATGACAAGCAGGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010734.2-166s21c1
Sequence:CCGGGGTTCAGTCAGAGAGTGAAGACTCGAGTCTTCACTCTCTGACTGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_010734.2-225s21c1
Sequence:CCGGCACTATGCATCTCTCCAGCAGCTCGAGCTGCTGGAGAGATGCATAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010734.1-75s1c1
Sequence:CCGGCCAATCATTTCCTGCTCTATGCTCGAGCATAGAGCAGGAAATGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)