EMAIL THIS PAGE TO A FRIEND

LTA4H

leukotriene A4 hydrolase

77 Gene Product Result for
UniProtKB ID: P09960, B4DNQ9, F8VV40, Q6IAT6, Q9UCT7
Gene ID:
Mouse(16993) leukotriene A4 hydrolase
Rat(299732) leukotriene A4 hydrolase
Zebrafish(406575) leukotriene A4 hydrolase
cow(507130) leukotriene A4 hydrolase
Horse(100052257) leukotriene A4 hydrolase
domestic cat(101083948) leukotriene A4 hydrolase
dog(482611) leukotriene A4 hydrolase
chicken(417918) leukotriene A4 hydrolase
Domestic Rabbit(100357727) leukotriene A4 hydrolase
naked mole-rat(101700383) leukotriene A4 hydrolase
domestic guinea pig(100135571) leukotriene A4 hydrolase
sheep(101121761) leukotriene A4 hydrolase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
P7495 SC 22716 ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000895 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000895 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000895 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008517 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008517 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008517 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000895 Rosetta Predictions human pricing
NM_001030031 Rosetta Predictions rat pricing
XM_001080297 Rosetta Predictions rat pricing
NM_008517 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143001 predicted 1725
2 SASI_Hs01_00143002 predicted 228
3 SASI_Hs02_00303453 predicted 1136
4 SASI_Hs01_00143003 predicted 1387
5 SASI_Hs01_00143004 predicted 1030
6 SASI_Hs01_00143005 predicted 712
7 SASI_Hs01_00143006 predicted 1045
8 SASI_Hs01_00143007 predicted 1108
9 SASI_Hs01_00143008 predicted 822
10 SASI_Hs01_00143009 predicted 1758
11 SASI_Hs01_00143000 predicted 1431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094581 predicted 796
2 SASI_Rn01_00094582 predicted 1357
3 SASI_Rn01_00094583 predicted 1651
4 SASI_Rn01_00094584 predicted 942
5 SASI_Rn01_00094585 predicted 661
6 SASI_Rn01_00094586 predicted 1318
7 SASI_Rn01_00094587 predicted 927
8 SASI_Rn01_00094588 predicted 1097
9 SASI_Rn02_00203538 predicted 1660
10 SASI_Rn01_00094589 predicted 1060
11 SASI_Rn01_00094590 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367507 predicted 761
2 SASI_Rn02_00367508 predicted 1325
3 SASI_Rn02_00367509 predicted 1620
4 SASI_Rn02_00367510 predicted 1704
5 SASI_Rn02_00367511 predicted 914
6 SASI_Rn02_00367512 predicted 1281
7 SASI_Rn02_00367513 predicted 590
8 SASI_Rn02_00367514 predicted 895
9 SASI_Rn02_00367515 predicted 1066
10 SASI_Rn02_00367516 predicted 1629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008517 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314087 predicted 1758
2 SASI_Mm02_00314088 predicted 1669
3 SASI_Mm02_00314089 predicted 1324
4 SASI_Mm02_00314090 predicted 1280
5 SASI_Mm01_00172689 predicted 700
6 SASI_Mm02_00314091 predicted 1353
7 SASI_Mm01_00172690 predicted 1482
8 SASI_Mm01_00172691 predicted 349
9 SASI_Mm02_00314092 predicted 980
10 SASI_Mm02_00314093 predicted 1018
11 SASI_Mm01_00172692 predicted 472
12 SASI_Mm01_00172693 predicted 575
13 SASI_Mm01_00172694 predicted 648
14 SASI_Mm01_00172695 predicted 661
15 SASI_Mm01_00172696 predicted 393
16 SASI_Mm01_00172697 predicted 670
17 SASI_Mm01_00172698 predicted 571
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000895
VALIDATED
LTA4H MISSION shRNA Bacterial Glycerol Stock
leukotriene A4 hydrolase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000895.1-519s21c1
Sequence:CCGGCCTTCTGTGAAATTAACCTATCTCGAGATAGGTTAATTTCACAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000895.1-663s21c1
Sequence:CCGGCCCTGCTACCTGATTGCTTTACTCGAGTAAAGCAATCAGGTAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000895.1-1718s21c1
Sequence:CCGGCGCAATTCCTTTGGCGCTAAACTCGAGTTTAGCGCCAAAGGAATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000895.1-1773s21c1
Sequence:CCGGCGGCCCTTATTCAAGGATCTTCTCGAGAAGATCCTTGAATAAGGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000895.1-1430s21c1
Sequence:CCGGGCCTCCCATAAAGCCCAATTACTCGAGTAATTGGGCTTTATGGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000895.1-1773s1c1
Sequence:CCGGCGGCCCTTATTCAAGGATCTTCTCGAGAAGATCCTTGAATAAGGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000895.1-1430s1c1
Sequence:CCGGGCCTCCCATAAAGCCCAATTACTCGAGTAATTGGGCTTTATGGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000895.1-663s1c1
Sequence:CCGGCCCTGCTACCTGATTGCTTTACTCGAGTAAAGCAATCAGGTAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000895.1-1718s1c1
Sequence:CCGGCGCAATTCCTTTGGCGCTAAACTCGAGTTTAGCGCCAAAGGAATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000895
VALIDATED
LTA4H MISSION shRNA shRNA Plasmid DNA
leukotriene A4 hydrolase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000895.1-519s21c1
Sequence:CCGGCCTTCTGTGAAATTAACCTATCTCGAGATAGGTTAATTTCACAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000895.1-663s21c1
Sequence:CCGGCCCTGCTACCTGATTGCTTTACTCGAGTAAAGCAATCAGGTAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000895.1-1718s21c1
Sequence:CCGGCGCAATTCCTTTGGCGCTAAACTCGAGTTTAGCGCCAAAGGAATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000895.1-1773s21c1
Sequence:CCGGCGGCCCTTATTCAAGGATCTTCTCGAGAAGATCCTTGAATAAGGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000895.1-1430s21c1
Sequence:CCGGGCCTCCCATAAAGCCCAATTACTCGAGTAATTGGGCTTTATGGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000895.1-1773s1c1
Sequence:CCGGCGGCCCTTATTCAAGGATCTTCTCGAGAAGATCCTTGAATAAGGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000895.1-1430s1c1
Sequence:CCGGGCCTCCCATAAAGCCCAATTACTCGAGTAATTGGGCTTTATGGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000895.1-663s1c1
Sequence:CCGGCCCTGCTACCTGATTGCTTTACTCGAGTAAAGCAATCAGGTAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000895.1-1718s1c1
Sequence:CCGGCGCAATTCCTTTGGCGCTAAACTCGAGTTTAGCGCCAAAGGAATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000895
VALIDATED
LTA4H MISSION shRNA Lentiviral Transduction Particles
leukotriene A4 hydrolase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000895.1-519s21c1
Sequence:CCGGCCTTCTGTGAAATTAACCTATCTCGAGATAGGTTAATTTCACAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000895.1-663s21c1
Sequence:CCGGCCCTGCTACCTGATTGCTTTACTCGAGTAAAGCAATCAGGTAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000895.1-1718s21c1
Sequence:CCGGCGCAATTCCTTTGGCGCTAAACTCGAGTTTAGCGCCAAAGGAATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000895.1-1773s21c1
Sequence:CCGGCGGCCCTTATTCAAGGATCTTCTCGAGAAGATCCTTGAATAAGGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000895.1-1430s21c1
Sequence:CCGGGCCTCCCATAAAGCCCAATTACTCGAGTAATTGGGCTTTATGGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000895.1-1773s1c1
Sequence:CCGGCGGCCCTTATTCAAGGATCTTCTCGAGAAGATCCTTGAATAAGGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000895.1-1430s1c1
Sequence:CCGGGCCTCCCATAAAGCCCAATTACTCGAGTAATTGGGCTTTATGGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000895.1-663s1c1
Sequence:CCGGCCCTGCTACCTGATTGCTTTACTCGAGTAAAGCAATCAGGTAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000895.1-1718s1c1
Sequence:CCGGCGCAATTCCTTTGGCGCTAAACTCGAGTTTAGCGCCAAAGGAATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008517
VALIDATED
LTA4H MISSION shRNA Bacterial Glycerol Stock
leukotriene A4 hydrolase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008517.1-715s1c1
Sequence:CCGGGCAGACAAATTGGCCCAAGAACTCGAGTTCTTGGGCCAATTTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008517.1-1034s1c1
Sequence:CCGGCGAAGGACATACTGTCTACTTCTCGAGAAGTAGACAGTATGTCCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008517.1-1360s1c1
Sequence:CCGGGCTTCCTATATTCCCACTTTACTCGAGTAAAGTGGGAATATAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008517.1-690s1c1
Sequence:CCGGGCTTTGGTTGTTGGAGCTTTACTCGAGTAAAGCTCCAACAACCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008517.1-304s1c1
Sequence:CCGGCCCTTGGAGAAAGTCAAGGTTCTCGAGAACCTTGACTTTCTCCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008517
VALIDATED
LTA4H MISSION shRNA shRNA Plasmid DNA
leukotriene A4 hydrolase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008517.1-715s1c1
Sequence:CCGGGCAGACAAATTGGCCCAAGAACTCGAGTTCTTGGGCCAATTTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008517.1-1034s1c1
Sequence:CCGGCGAAGGACATACTGTCTACTTCTCGAGAAGTAGACAGTATGTCCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008517.1-1360s1c1
Sequence:CCGGGCTTCCTATATTCCCACTTTACTCGAGTAAAGTGGGAATATAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008517.1-690s1c1
Sequence:CCGGGCTTTGGTTGTTGGAGCTTTACTCGAGTAAAGCTCCAACAACCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008517.1-304s1c1
Sequence:CCGGCCCTTGGAGAAAGTCAAGGTTCTCGAGAACCTTGACTTTCTCCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008517
VALIDATED
LTA4H MISSION shRNA Lentiviral Transduction Particles
leukotriene A4 hydrolase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008517.1-715s1c1
Sequence:CCGGGCAGACAAATTGGCCCAAGAACTCGAGTTCTTGGGCCAATTTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008517.1-1034s1c1
Sequence:CCGGCGAAGGACATACTGTCTACTTCTCGAGAAGTAGACAGTATGTCCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008517.1-1360s1c1
Sequence:CCGGGCTTCCTATATTCCCACTTTACTCGAGTAAAGTGGGAATATAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008517.1-690s1c1
Sequence:CCGGGCTTTGGTTGTTGGAGCTTTACTCGAGTAAAGCTCCAACAACCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008517.1-304s1c1
Sequence:CCGGCCCTTGGAGAAAGTCAAGGTTCTCGAGAACCTTGACTTTCTCCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)