EMAIL THIS PAGE TO A FRIEND

LTB4R2

leukotriene B4 receptor 2

42 Gene Product Result for
Synonyms: BLT2 BLTR2 JULF2 KPG_004 LTB4-R 2 LTB4-R2 NOP9
UniProtKB ID: Q9NPC1, Q5KU28, Q9NPE5
Gene ID:
Mouse(57260) leukotriene B4 receptor 2
Rat(114098) leukotriene B4 receptor 2
cow(513386) leukotriene B4 receptor 2
dog(490624) leukotriene B4 receptor 2
sheep(101119396) leukotriene B4 receptor 2
domestic guinea pig(100735016) leukotriene B4 receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020490 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020490 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020490 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019839 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019839 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019839 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019839 Rosetta Predictions human pricing
NM_053640 Rosetta Predictions rat pricing
NM_020490 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098366 predicted 1986
2 SASI_Hs01_00098367 predicted 1981
3 SASI_Hs01_00098368 predicted 1925
4 SASI_Hs01_00098369 predicted 1980
5 SASI_Hs01_00098370 predicted 1693
6 SASI_Hs01_00098371 predicted 1930
7 SASI_Hs01_00098372 predicted 1872
8 SASI_Hs01_00098373 predicted 1813
9 SASI_Hs01_00098374 predicted 1697
10 SASI_Hs01_00098375 predicted 1904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053640 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094300 predicted 843
2 SASI_Rn01_00094301 predicted 598
3 SASI_Rn01_00094302 predicted 808
4 SASI_Rn01_00094303 predicted 846
5 SASI_Rn01_00094304 predicted 813
6 SASI_Rn01_00094306 predicted 297
7 SASI_Rn01_00094307 predicted 524
8 SASI_Rn02_00266363 predicted 547
9 SASI_Rn01_00094308 predicted 679
10 SASI_Rn02_00266364 predicted 745
11 SASI_Rn01_00094305 predicted 656
12 SASI_Rn01_00094309 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143132 predicted 269
2 SASI_Mm01_00143133 predicted 554
3 SASI_Mm01_00143134 predicted 836
4 SASI_Mm01_00143135 predicted 664
5 SASI_Mm01_00143136 predicted 709
6 SASI_Mm01_00143137 predicted 844
7 SASI_Mm01_00143138 predicted 809
8 SASI_Mm01_00143139 predicted 462
9 SASI_Mm01_00143140 predicted 278
10 SASI_Mm01_00143141 predicted 710
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020490
LTB4R2 MISSION shRNA Bacterial Glycerol Stock
leukotriene B4 receptor 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020490.1-813s1c1
Sequence:CCGGTGGAACTACAGCCTTGGCTTTCTCGAGAAAGCCAAGGCTGTAGTTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020490.1-360s1c1
Sequence:CCGGCCTGGCTGTCACTCGGCCCTTCTCGAGAAGGGCCGAGTGACAGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020490.1-853s1c1
Sequence:CCGGCCAGTGCTCTATGTCTTCACTCTCGAGAGTGAAGACATAGAGCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020490.1-30s1c1
Sequence:CCGGTGAGACACTACTGAGCTGGAACTCGAGTTCCAGCTCAGTAGTGTCTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020490.1-903s1c1
Sequence:CCGGTCGGTTCCTTACTCGACTCTTCTCGAGAAGAGTCGAGTAAGGAACCGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000451680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020490.1-720s21c1
Sequence:CCGGCCACGCGGTCAATCTCCTACACTCGAGTGTAGGAGATTGACCGCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020490.1-987s21c1
Sequence:CCGGTACTCCTAAGCTGAAAGTAATCTCGAGATTACTTTCAGCTTAGGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020490
LTB4R2 MISSION shRNA shRNA Plasmid DNA
leukotriene B4 receptor 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020490.1-813s1c1
Sequence:CCGGTGGAACTACAGCCTTGGCTTTCTCGAGAAAGCCAAGGCTGTAGTTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020490.1-360s1c1
Sequence:CCGGCCTGGCTGTCACTCGGCCCTTCTCGAGAAGGGCCGAGTGACAGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020490.1-853s1c1
Sequence:CCGGCCAGTGCTCTATGTCTTCACTCTCGAGAGTGAAGACATAGAGCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020490.1-30s1c1
Sequence:CCGGTGAGACACTACTGAGCTGGAACTCGAGTTCCAGCTCAGTAGTGTCTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020490.1-903s1c1
Sequence:CCGGTCGGTTCCTTACTCGACTCTTCTCGAGAAGAGTCGAGTAAGGAACCGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000451680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020490.1-720s21c1
Sequence:CCGGCCACGCGGTCAATCTCCTACACTCGAGTGTAGGAGATTGACCGCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020490.1-987s21c1
Sequence:CCGGTACTCCTAAGCTGAAAGTAATCTCGAGATTACTTTCAGCTTAGGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020490
LTB4R2 MISSION shRNA Lentiviral Transduction Particles
leukotriene B4 receptor 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020490.1-813s1c1
Sequence:CCGGTGGAACTACAGCCTTGGCTTTCTCGAGAAAGCCAAGGCTGTAGTTCCATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020490.1-360s1c1
Sequence:CCGGCCTGGCTGTCACTCGGCCCTTCTCGAGAAGGGCCGAGTGACAGCCAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020490.1-853s1c1
Sequence:CCGGCCAGTGCTCTATGTCTTCACTCTCGAGAGTGAAGACATAGAGCACTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020490.1-30s1c1
Sequence:CCGGTGAGACACTACTGAGCTGGAACTCGAGTTCCAGCTCAGTAGTGTCTCATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020490.1-903s1c1
Sequence:CCGGTCGGTTCCTTACTCGACTCTTCTCGAGAAGAGTCGAGTAAGGAACCGATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000451680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020490.1-720s21c1
Sequence:CCGGCCACGCGGTCAATCTCCTACACTCGAGTGTAGGAGATTGACCGCGTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000449820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020490.1-987s21c1
Sequence:CCGGTACTCCTAAGCTGAAAGTAATCTCGAGATTACTTTCAGCTTAGGAGTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019839
LTB4R2 MISSION shRNA Bacterial Glycerol Stock
leukotriene B4 receptor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019839.3-2851s21c1
Sequence:CCGGGTCAGTGTTCTGGGACATTTGCTCGAGCAAATGTCCCAGAACACTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019839.3-2534s21c1
Sequence:CCGGCCTTGGCCTTCTTCAGTTCTACTCGAGTAGAACTGAAGAAGGCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019839.1-1677s1c1
Sequence:CCGGTGTGGCGCCTTCCACCCACCTCTCGAGAGGTGGGTGGAAGGCGCCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019839.1-2614s1c1
Sequence:CCGGCCGTTTCCTCACGCGGCTCTTCTCGAGAAGAGCCGCGTGAGGAAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019839.1-2281s1c1
Sequence:CCGGCGTGCTTCCTTTCGGGCTGATCTCGAGATCAGCCCGAAAGGAAGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019839.1-2542s1c1
Sequence:CCGGCTTCTTCAGTTCTAGCGTCAACTCGAGTTGACGCTAGAACTGAAGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019839.3-2271s21c1
Sequence:CCGGGACCGCTTTCGTGCTTCCTTTCTCGAGAAAGGAAGCACGAAAGCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019839.3-2783s21c1
Sequence:CCGGTTTGACAGCAGACCCTACAACCTCGAGGTTGTAGGGTCTGCTGTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019839.3-2896s21c1
Sequence:CCGGGGATCTGGCTGGGTAGGATTACTCGAGTAATCCTACCCAGCCAGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019839
LTB4R2 MISSION shRNA shRNA Plasmid DNA
leukotriene B4 receptor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019839.3-2851s21c1
Sequence:CCGGGTCAGTGTTCTGGGACATTTGCTCGAGCAAATGTCCCAGAACACTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019839.3-2534s21c1
Sequence:CCGGCCTTGGCCTTCTTCAGTTCTACTCGAGTAGAACTGAAGAAGGCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019839.1-1677s1c1
Sequence:CCGGTGTGGCGCCTTCCACCCACCTCTCGAGAGGTGGGTGGAAGGCGCCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019839.1-2614s1c1
Sequence:CCGGCCGTTTCCTCACGCGGCTCTTCTCGAGAAGAGCCGCGTGAGGAAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019839.1-2281s1c1
Sequence:CCGGCGTGCTTCCTTTCGGGCTGATCTCGAGATCAGCCCGAAAGGAAGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019839.1-2542s1c1
Sequence:CCGGCTTCTTCAGTTCTAGCGTCAACTCGAGTTGACGCTAGAACTGAAGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019839.3-2271s21c1
Sequence:CCGGGACCGCTTTCGTGCTTCCTTTCTCGAGAAAGGAAGCACGAAAGCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019839.3-2783s21c1
Sequence:CCGGTTTGACAGCAGACCCTACAACCTCGAGGTTGTAGGGTCTGCTGTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019839.3-2896s21c1
Sequence:CCGGGGATCTGGCTGGGTAGGATTACTCGAGTAATCCTACCCAGCCAGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019839
LTB4R2 MISSION shRNA Lentiviral Transduction Particles
leukotriene B4 receptor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019839.3-2851s21c1
Sequence:CCGGGTCAGTGTTCTGGGACATTTGCTCGAGCAAATGTCCCAGAACACTGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000357530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019839.3-2534s21c1
Sequence:CCGGCCTTGGCCTTCTTCAGTTCTACTCGAGTAGAACTGAAGAAGGCCAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000011731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019839.1-1677s1c1
Sequence:CCGGTGTGGCGCCTTCCACCCACCTCTCGAGAGGTGGGTGGAAGGCGCCACATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000011729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019839.1-2614s1c1
Sequence:CCGGCCGTTTCCTCACGCGGCTCTTCTCGAGAAGAGCCGCGTGAGGAAACGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000011728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019839.1-2281s1c1
Sequence:CCGGCGTGCTTCCTTTCGGGCTGATCTCGAGATCAGCCCGAAAGGAAGCACGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000011727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019839.1-2542s1c1
Sequence:CCGGCTTCTTCAGTTCTAGCGTCAACTCGAGTTGACGCTAGAACTGAAGAAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000357532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019839.3-2271s21c1
Sequence:CCGGGACCGCTTTCGTGCTTCCTTTCTCGAGAAAGGAAGCACGAAAGCGGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000357531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019839.3-2783s21c1
Sequence:CCGGTTTGACAGCAGACCCTACAACCTCGAGGTTGTAGGGTCTGCTGTCAAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000368542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019839.3-2896s21c1
Sequence:CCGGGGATCTGGCTGGGTAGGATTACTCGAGTAATCCTACCCAGCCAGATCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???