EMAIL THIS PAGE TO A FRIEND

LTB4R

leukotriene B4 receptor

44 Gene Product Result for
Synonyms: BLT1 BLTR CMKRL1 GPR16 LTB4R1 LTBR1 P2RY7 P2Y7
UniProtKB ID: Q15722, Q13305, Q53XV5, Q92641, Q9BSU5
Gene ID:
Rat(59264) leukotriene B4 receptor
chicken(415617) leukotriene B4 receptor
chicken(427729) leukotriene B4 receptor
cow(613482) leukotriene B4 receptor
dog(100686275) leukotriene B4 receptor
domestic cat(101083519) leukotriene B4 receptor
dog(608461) leukotriene B4 receptor
naked mole-rat(101721798) leukotriene B4 receptor
domestic guinea pig(100379538) leukotriene B4 receptor
sheep(101113240) leukotriene B4 receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181657 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU218781 MISSION® esiRNA esiRNA targeting human LTB4R human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181657 Rosetta Predictions human pricing
NM_021656 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063716 predicted 2135
2 SASI_Hs01_00063717 predicted 1822
3 SASI_Hs01_00063718 predicted 2031
4 SASI_Hs01_00063719 predicted 2322
5 SASI_Hs01_00063720 predicted 1987
6 SASI_Hs01_00063721 predicted 1814
7 SASI_Hs01_00063722 predicted 2007
8 SASI_Hs01_00063723 predicted 2039
9 SASI_Hs01_00063724 predicted 1774
10 SASI_Hs01_00063725 predicted 1741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084108 predicted 453
2 SASI_Rn01_00084110 predicted 526
3 SASI_Rn01_00084111 predicted 417
4 SASI_Rn01_00084112 predicted 206
5 SASI_Rn01_00084113 predicted 779
6 SASI_Rn01_00084114 predicted 833
7 SASI_Rn01_00084115 predicted 709
8 SASI_Rn01_00084116 predicted 480
9 SASI_Rn02_00262651 predicted 285
10 SASI_Rn01_00084117 predicted 692
11 SASI_Rn01_00084109 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181657
LTB4R MISSION shRNA Bacterial Glycerol Stock
leukotriene B4 receptor
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.3-2522s21c1
Sequence:CCGGTGGCCAGCTACTCGGACATAGCTCGAGCTATGTCCGAGTAGCTGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181657.1-2823s21c1
Sequence:CCGGTGAGCCAGTTCAGTACCTGGACTCGAGTCCAGGTACTGAACTGGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.1-1984s21c1
Sequence:CCGGTTGCCGCCTGTGTCACTATGTCTCGAGACATAGTGACACAGGCGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.1-1826s21c1
Sequence:CCGGAGCTTTGTGGTGTGGAGTATCCTCGAGGATACTCCACACCACAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.1-2249s21c1
Sequence:CCGGCGGGCCTTCCATCTAATCTTCCTCGAGGAAGATTAGATGGAAGGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.1-2038s21c1
Sequence:CCGGTATCACGGCCATGAGTCTAGACTCGAGTCTAGACTCATGGCCGTGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181657.3-3388s21c1
Sequence:CCGGGTACATAGTCTGCAGATAATACTCGAGTATTATCTGCAGACTATGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.3-2961s21c1
Sequence:CCGGCCCTCTCAAGTTAAACGAACTCTCGAGAGTTCGTTTAACTTGAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.3-1975s21c1
Sequence:CCGGTTCATCTCTCTGCTGGCTATCCTCGAGGATAGCCAGCAGAGAGATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181657.1-2793s1c1
Sequence:CCGGCGCACTTTCCTCCTGGCAGAACTCGAGTTCTGCCAGGAGGAAAGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181657.1-1762s1c1
Sequence:CCGGGTTCATCTCTCTGCTGGCTATCTCGAGATAGCCAGCAGAGAGATGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181657.1-1864s1c1
Sequence:CCGGGCGCTCTGTCACTGCCCTGATCTCGAGATCAGGGCAGTGACAGAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181657.1-2183s1c1
Sequence:CCGGCGCACAGTAGTGCCCTGGAAACTCGAGTTTCCAGGGCACTACTGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181657.1-2752s1c1
Sequence:CCGGTCTCAAGTTAAACGAACTGAACTCGAGTTCAGTTCGTTTAACTTGAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181657
LTB4R MISSION shRNA shRNA Plasmid DNA
leukotriene B4 receptor
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.3-2522s21c1
Sequence:CCGGTGGCCAGCTACTCGGACATAGCTCGAGCTATGTCCGAGTAGCTGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181657.1-2823s21c1
Sequence:CCGGTGAGCCAGTTCAGTACCTGGACTCGAGTCCAGGTACTGAACTGGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.1-1984s21c1
Sequence:CCGGTTGCCGCCTGTGTCACTATGTCTCGAGACATAGTGACACAGGCGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.1-1826s21c1
Sequence:CCGGAGCTTTGTGGTGTGGAGTATCCTCGAGGATACTCCACACCACAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.1-2249s21c1
Sequence:CCGGCGGGCCTTCCATCTAATCTTCCTCGAGGAAGATTAGATGGAAGGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.1-2038s21c1
Sequence:CCGGTATCACGGCCATGAGTCTAGACTCGAGTCTAGACTCATGGCCGTGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181657.3-3388s21c1
Sequence:CCGGGTACATAGTCTGCAGATAATACTCGAGTATTATCTGCAGACTATGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.3-2961s21c1
Sequence:CCGGCCCTCTCAAGTTAAACGAACTCTCGAGAGTTCGTTTAACTTGAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.3-1975s21c1
Sequence:CCGGTTCATCTCTCTGCTGGCTATCCTCGAGGATAGCCAGCAGAGAGATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181657.1-2793s1c1
Sequence:CCGGCGCACTTTCCTCCTGGCAGAACTCGAGTTCTGCCAGGAGGAAAGTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181657.1-1762s1c1
Sequence:CCGGGTTCATCTCTCTGCTGGCTATCTCGAGATAGCCAGCAGAGAGATGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181657.1-1864s1c1
Sequence:CCGGGCGCTCTGTCACTGCCCTGATCTCGAGATCAGGGCAGTGACAGAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181657.1-2183s1c1
Sequence:CCGGCGCACAGTAGTGCCCTGGAAACTCGAGTTTCCAGGGCACTACTGTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181657.1-2752s1c1
Sequence:CCGGTCTCAAGTTAAACGAACTGAACTCGAGTTCAGTTCGTTTAACTTGAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181657
LTB4R MISSION shRNA Lentiviral Transduction Particles
leukotriene B4 receptor
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.3-2522s21c1
Sequence:CCGGTGGCCAGCTACTCGGACATAGCTCGAGCTATGTCCGAGTAGCTGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181657.1-2823s21c1
Sequence:CCGGTGAGCCAGTTCAGTACCTGGACTCGAGTCCAGGTACTGAACTGGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.1-1984s21c1
Sequence:CCGGTTGCCGCCTGTGTCACTATGTCTCGAGACATAGTGACACAGGCGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.1-1826s21c1
Sequence:CCGGAGCTTTGTGGTGTGGAGTATCCTCGAGGATACTCCACACCACAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.1-2249s21c1
Sequence:CCGGCGGGCCTTCCATCTAATCTTCCTCGAGGAAGATTAGATGGAAGGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.1-2038s21c1
Sequence:CCGGTATCACGGCCATGAGTCTAGACTCGAGTCTAGACTCATGGCCGTGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181657.3-3388s21c1
Sequence:CCGGGTACATAGTCTGCAGATAATACTCGAGTATTATCTGCAGACTATGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.3-2961s21c1
Sequence:CCGGCCCTCTCAAGTTAAACGAACTCTCGAGAGTTCGTTTAACTTGAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181657.3-1975s21c1
Sequence:CCGGTTCATCTCTCTGCTGGCTATCCTCGAGGATAGCCAGCAGAGAGATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181657.1-2793s1c1
Sequence:CCGGCGCACTTTCCTCCTGGCAGAACTCGAGTTCTGCCAGGAGGAAAGTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181657.1-1762s1c1
Sequence:CCGGGTTCATCTCTCTGCTGGCTATCTCGAGATAGCCAGCAGAGAGATGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181657.1-1864s1c1
Sequence:CCGGGCGCTCTGTCACTGCCCTGATCTCGAGATCAGGGCAGTGACAGAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181657.1-2183s1c1
Sequence:CCGGCGCACAGTAGTGCCCTGGAAACTCGAGTTTCCAGGGCACTACTGTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181657.1-2752s1c1
Sequence:CCGGTCTCAAGTTAAACGAACTGAACTCGAGTTCAGTTCGTTTAACTTGAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)