EMAIL THIS PAGE TO A FRIEND

LTBP2

latent transforming growth factor beta binding protein 2

53 Gene Product Result for
Synonyms: C14orf141 GLC3D LTBP3 MSPKA MSTP031 WMS3
UniProtKB ID: Q14767, Q99907, Q9NS51
Gene ID:
Human(4053) Summary: The protein encoded by this gene belongs to the family of latent transforming growth factor (TGF)-beta binding proteins (LTBP), which are extracellular matrix proteins with multi-domain structure. This protein is the largest member of the LTBP family possessing unique regions and with most similarity to the fibrillins. It has thus been suggested that it may have multiple functions: as a member of the TGF-beta latent complex, as a structural component of microfibrils, and a role in cell adhesion. [provided by RefSeq, Jul 2008]
Mouse(16997) latent transforming growth factor beta binding protein 2
Rat(59106) latent transforming growth factor beta binding protein 2
chicken(428888) latent transforming growth factor beta binding protein 2
dog(490784) latent transforming growth factor beta binding protein 2
cow(281905) latent transforming growth factor beta binding protein 2
domestic cat(101083010) latent transforming growth factor beta binding protein 2
sheep(101107605) latent transforming growth factor beta binding protein 2
naked mole-rat(101699870) latent transforming growth factor beta binding protein 2
domestic guinea pig(100722826) latent transforming growth factor beta binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013589 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013589 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013589 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000428 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000428 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000428 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154981 MISSION® esiRNA esiRNA human LTBP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000428 Rosetta Predictions human pricing
NM_021586 Rosetta Predictions rat pricing
NM_013589 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102336 predicted 3254
2 SASI_Hs01_00102337 predicted 4425
3 SASI_Hs01_00102339 predicted 5150
4 SASI_Hs01_00102340 predicted 3488
5 SASI_Hs01_00102341 predicted 4762
6 SASI_Hs01_00102342 predicted 1565
7 SASI_Hs02_00302536 predicted 4102
8 SASI_Hs02_00302537 predicted 2243
9 SASI_Hs01_00102343 predicted 3616
10 SASI_Hs01_00102344 predicted 4957
11 SASI_Hs01_00102335 predicted 1744
12 SASI_Hs01_00102338 predicted 5943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021586 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066638 predicted 202
2 SASI_Rn02_00262626 predicted 5457
3 SASI_Rn01_00066639 predicted 985
4 SASI_Rn01_00066640 predicted 1256
5 SASI_Rn01_00066641 predicted 2150
6 SASI_Rn01_00066642 predicted 5204
7 SASI_Rn01_00066644 predicted 2444
8 SASI_Rn01_00066645 predicted 5423
9 SASI_Rn02_00262627 predicted 4369
10 SASI_Rn01_00066646 predicted 521
11 SASI_Rn01_00066643 predicted 4321
12 SASI_Rn01_00066647 predicted 3181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024703 predicted 2983
2 SASI_Mm02_00322329 predicted 3968
3 SASI_Mm01_00024704 predicted 350
4 SASI_Mm01_00024705 predicted 2727
5 SASI_Mm01_00024707 predicted 4518
6 SASI_Mm01_00024708 predicted 1401
7 SASI_Mm02_00322330 predicted 4323
8 SASI_Mm01_00024709 predicted 3420
9 SASI_Mm01_00024710 predicted 4464
10 SASI_Mm02_00322331 predicted 4603
11 SASI_Mm01_00024702 predicted 5586
12 SASI_Mm01_00024706 predicted 4157
13 SASI_Mm01_00024711 predicted 3544
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013589
LTBP2 MISSION shRNA Bacterial Glycerol Stock
latent transforming growth factor beta binding protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013589.1-1442s1c1
Sequence:CCGGCCGTATCTATTTCTGCCAAATCTCGAGATTTGGCAGAAATAGATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013589.1-2748s1c1
Sequence:CCGGCCAGCAGAAGAGCAAGTGATTCTCGAGAATCACTTGCTCTTCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013589.1-3543s1c1
Sequence:CCGGGCCTGTGAAGACTTGGATGAACTCGAGTTCATCCAAGTCTTCACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013589.1-4734s1c1
Sequence:CCGGGCCGATGAATGTGTACTGTTTCTCGAGAAACAGTACACATTCATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013589.1-2863s1c1
Sequence:CCGGGCCTCCCAAATGGATACAGATCTCGAGATCTGTATCCATTTGGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013589
LTBP2 MISSION shRNA shRNA Plasmid DNA
latent transforming growth factor beta binding protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013589.1-1442s1c1
Sequence:CCGGCCGTATCTATTTCTGCCAAATCTCGAGATTTGGCAGAAATAGATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013589.1-2748s1c1
Sequence:CCGGCCAGCAGAAGAGCAAGTGATTCTCGAGAATCACTTGCTCTTCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013589.1-3543s1c1
Sequence:CCGGGCCTGTGAAGACTTGGATGAACTCGAGTTCATCCAAGTCTTCACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013589.1-4734s1c1
Sequence:CCGGGCCGATGAATGTGTACTGTTTCTCGAGAAACAGTACACATTCATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013589.1-2863s1c1
Sequence:CCGGGCCTCCCAAATGGATACAGATCTCGAGATCTGTATCCATTTGGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013589
LTBP2 MISSION shRNA Lentiviral Transduction Particles
latent transforming growth factor beta binding protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013589.1-1442s1c1
Sequence:CCGGCCGTATCTATTTCTGCCAAATCTCGAGATTTGGCAGAAATAGATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013589.1-2748s1c1
Sequence:CCGGCCAGCAGAAGAGCAAGTGATTCTCGAGAATCACTTGCTCTTCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013589.1-3543s1c1
Sequence:CCGGGCCTGTGAAGACTTGGATGAACTCGAGTTCATCCAAGTCTTCACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013589.1-4734s1c1
Sequence:CCGGGCCGATGAATGTGTACTGTTTCTCGAGAAACAGTACACATTCATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013589.1-2863s1c1
Sequence:CCGGGCCTCCCAAATGGATACAGATCTCGAGATCTGTATCCATTTGGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000428
LTBP2 MISSION shRNA Bacterial Glycerol Stock
latent transforming growth factor beta binding protein 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000428.2-5131s1c1
Sequence:CCGGCACATGGACATCTGCTGGAAACTCGAGTTTCCAGCAGATGTCCATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000428.2-1572s1c1
Sequence:CCGGCCGCATCTATTTCTGCCAGATCTCGAGATCTGGCAGAAATAGATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000428.2-918s1c1
Sequence:CCGGGACAACAGCAAACAGCACCAACTCGAGTTGGTGCTGTTTGCTGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000428.2-4840s1c1
Sequence:CCGGGATGCGGATGAGTGTGTGATACTCGAGTATCACACACTCATCCGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000428.2-3279s1c1
Sequence:CCGGGAAAGGACACTGCCAAGATATCTCGAGATATCTTGGCAGTGTCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000428.2-2453s21c1
Sequence:CCGGAGCGGATCACCAAGCAGATATCTCGAGATATCTGCTTGGTGATCCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000428.2-4166s21c1
Sequence:CCGGTTGACGAGTGTGAGGACTATGCTCGAGCATAGTCCTCACACTCGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000428
LTBP2 MISSION shRNA shRNA Plasmid DNA
latent transforming growth factor beta binding protein 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000428.2-5131s1c1
Sequence:CCGGCACATGGACATCTGCTGGAAACTCGAGTTTCCAGCAGATGTCCATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000428.2-1572s1c1
Sequence:CCGGCCGCATCTATTTCTGCCAGATCTCGAGATCTGGCAGAAATAGATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000428.2-918s1c1
Sequence:CCGGGACAACAGCAAACAGCACCAACTCGAGTTGGTGCTGTTTGCTGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000428.2-4840s1c1
Sequence:CCGGGATGCGGATGAGTGTGTGATACTCGAGTATCACACACTCATCCGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000428.2-3279s1c1
Sequence:CCGGGAAAGGACACTGCCAAGATATCTCGAGATATCTTGGCAGTGTCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000428.2-2453s21c1
Sequence:CCGGAGCGGATCACCAAGCAGATATCTCGAGATATCTGCTTGGTGATCCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000428.2-4166s21c1
Sequence:CCGGTTGACGAGTGTGAGGACTATGCTCGAGCATAGTCCTCACACTCGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000428
LTBP2 MISSION shRNA Lentiviral Transduction Particles
latent transforming growth factor beta binding protein 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000428.2-5131s1c1
Sequence:CCGGCACATGGACATCTGCTGGAAACTCGAGTTTCCAGCAGATGTCCATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000428.2-1572s1c1
Sequence:CCGGCCGCATCTATTTCTGCCAGATCTCGAGATCTGGCAGAAATAGATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000428.2-918s1c1
Sequence:CCGGGACAACAGCAAACAGCACCAACTCGAGTTGGTGCTGTTTGCTGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000428.2-4840s1c1
Sequence:CCGGGATGCGGATGAGTGTGTGATACTCGAGTATCACACACTCATCCGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000428.2-3279s1c1
Sequence:CCGGGAAAGGACACTGCCAAGATATCTCGAGATATCTTGGCAGTGTCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000428.2-2453s21c1
Sequence:CCGGAGCGGATCACCAAGCAGATATCTCGAGATATCTGCTTGGTGATCCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000428.2-4166s21c1
Sequence:CCGGTTGACGAGTGTGAGGACTATGCTCGAGCATAGTCCTCACACTCGTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)