EMAIL THIS PAGE TO A FRIEND

LTBP3

latent transforming growth factor beta binding protein 3

159 Gene Product Result for
Synonyms: LTBP-3 LTBP2 STHAG6 pp6425
UniProtKB ID: Q9NS15, O15107, Q96HB9, Q9H7K2, Q9UFN4
Gene ID:
Human(4054) Summary: The protein encoded by this gene forms a complex with transforming growth factor beta (TGF-beta) proteins and may be involved in their subcellular localization. Activation of this complex requires removal of the encoded binding protein. This protein also may play a structural role in the extracellular matrix. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
Mouse(16998) latent transforming growth factor beta binding protein 3
Rat(83838) latent transforming growth factor beta binding protein 3
domestic guinea pig(100724089) latent transforming growth factor beta binding protein 3
naked mole-rat(101721853) latent transforming growth factor beta binding protein 3
sheep(101122993) latent transforming growth factor beta binding protein 3
Zebrafish(562912) latent transforming growth factor beta binding protein 3
Horse(100146561) latent transforming growth factor beta binding protein 3
dog(483736) latent transforming growth factor beta binding protein 3
domestic cat(101097917) latent transforming growth factor beta binding protein 3
cow(532772) latent transforming growth factor beta binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA073170 Anti-LTBP3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021070 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008520 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008520 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008520 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021070 Rosetta Predictions human pricing
XM_341997 Rosetta Predictions rat pricing
NM_008520 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194254 predicted 1402
2 SASI_Hs01_00194255 predicted 2871
3 SASI_Hs01_00194257 predicted 1719
4 SASI_Hs01_00194258 predicted 541
5 SASI_Hs01_00194259 predicted 2026
6 SASI_Hs01_00194260 predicted 3493
7 SASI_Hs01_00194261 predicted 2983
8 SASI_Hs01_00194262 predicted 2649
9 SASI_Hs02_00354542 predicted 2404
10 SASI_Hs02_00354543 predicted 2381
11 SASI_Hs01_00194253 predicted 2977
12 SASI_Hs01_00194256 predicted 2772
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00135635 predicted 2201
2 SASI_Rn01_00135636 predicted 2036
3 SASI_Rn01_00135637 predicted 2744
4 SASI_Rn01_00135638 predicted 2146
5 SASI_Rn01_00135639 predicted 3378
6 SASI_Rn01_00135640 predicted 3877
7 SASI_Rn01_00135641 predicted 3278
8 SASI_Rn01_00135642 predicted 1246
9 SASI_Rn01_00135643 predicted 3242
10 SASI_Rn01_00135644 predicted 2421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008520 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110787 predicted 2997
2 SASI_Mm01_00110788 predicted 3850
3 SASI_Mm01_00110790 predicted 3777
4 SASI_Mm02_00314100 predicted 3560
5 SASI_Mm01_00110791 predicted 3779
6 SASI_Mm01_00110792 predicted 2705
7 SASI_Mm01_00110793 predicted 4772
8 SASI_Mm01_00110794 predicted 2084
9 SASI_Mm01_00110795 predicted 3753
10 SASI_Mm01_00110796 predicted 3737
11 SASI_Mm01_00110789 predicted 3034
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021070
VALIDATED
LTBP3 MISSION shRNA Bacterial Glycerol Stock
latent transforming growth factor beta binding protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021070.4-448s21c1
Sequence:CCGGAGCGCTTCAAGGTGGTCTTTGCTCGAGCAAAGACCACCTTGAAGCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021070.4-4265s21c1
Sequence:CCGGGTTTCCTAGAAACTGATAAATCTCGAGATTTATCAGTTTCTAGGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021070.4-3047s21c1
Sequence:CCGGAGTGTTCTGCGACAGCGTATTCTCGAGAATACGCTGTCGCAGAACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021070.2-3437s1c1
Sequence:CCGGGCAATTCCTTCTGGGACACAACTCGAGTTGTGTCCCAGAAGGAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021070.2-2028s1c1
Sequence:CCGGCATCAACTTTCCCGGTCACTACTCGAGTAGTGACCGGGAAAGTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_021070.2-1026s1c1
Sequence:CCGGCCAGGGCTACAAGAGGCTTAACTCGAGTTAAGCCTCTTGTAGCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021070.2-2523s1c1
Sequence:CCGGCATCAATACCAATGGCTCCTACTCGAGTAGGAGCCATTGGTATTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_021070.2-2934s1c1
Sequence:CCGGCCAGGACAACAACATCGTCAACTCGAGTTGACGATGTTGTTGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021070.2-3437s1c2
Sequence:CCGGGCAATTCCTTCTGGGACACAACTCGAGTTGTGTCCCAGAAGGAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021070.4-3262s21c1
Sequence:CCGGTGTTGTTCGGGTCGGAGATTTCTCGAGAAATCTCCGACCCGAACAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021070
VALIDATED
LTBP3 MISSION shRNA shRNA Plasmid DNA
latent transforming growth factor beta binding protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021070.4-448s21c1
Sequence:CCGGAGCGCTTCAAGGTGGTCTTTGCTCGAGCAAAGACCACCTTGAAGCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021070.4-4265s21c1
Sequence:CCGGGTTTCCTAGAAACTGATAAATCTCGAGATTTATCAGTTTCTAGGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021070.4-3047s21c1
Sequence:CCGGAGTGTTCTGCGACAGCGTATTCTCGAGAATACGCTGTCGCAGAACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021070.2-3437s1c1
Sequence:CCGGGCAATTCCTTCTGGGACACAACTCGAGTTGTGTCCCAGAAGGAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021070.2-2028s1c1
Sequence:CCGGCATCAACTTTCCCGGTCACTACTCGAGTAGTGACCGGGAAAGTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_021070.2-1026s1c1
Sequence:CCGGCCAGGGCTACAAGAGGCTTAACTCGAGTTAAGCCTCTTGTAGCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021070.2-2523s1c1
Sequence:CCGGCATCAATACCAATGGCTCCTACTCGAGTAGGAGCCATTGGTATTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_021070.2-2934s1c1
Sequence:CCGGCCAGGACAACAACATCGTCAACTCGAGTTGACGATGTTGTTGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021070.2-3437s1c2
Sequence:CCGGGCAATTCCTTCTGGGACACAACTCGAGTTGTGTCCCAGAAGGAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021070.4-3262s21c1
Sequence:CCGGTGTTGTTCGGGTCGGAGATTTCTCGAGAAATCTCCGACCCGAACAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021070
VALIDATED
LTBP3 MISSION shRNA Lentiviral Transduction Particles
latent transforming growth factor beta binding protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021070.4-448s21c1
Sequence:CCGGAGCGCTTCAAGGTGGTCTTTGCTCGAGCAAAGACCACCTTGAAGCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021070.4-4265s21c1
Sequence:CCGGGTTTCCTAGAAACTGATAAATCTCGAGATTTATCAGTTTCTAGGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021070.4-3047s21c1
Sequence:CCGGAGTGTTCTGCGACAGCGTATTCTCGAGAATACGCTGTCGCAGAACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021070.2-3437s1c1
Sequence:CCGGGCAATTCCTTCTGGGACACAACTCGAGTTGTGTCCCAGAAGGAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021070.2-2028s1c1
Sequence:CCGGCATCAACTTTCCCGGTCACTACTCGAGTAGTGACCGGGAAAGTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_021070.2-1026s1c1
Sequence:CCGGCCAGGGCTACAAGAGGCTTAACTCGAGTTAAGCCTCTTGTAGCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021070.2-2523s1c1
Sequence:CCGGCATCAATACCAATGGCTCCTACTCGAGTAGGAGCCATTGGTATTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_021070.2-2934s1c1
Sequence:CCGGCCAGGACAACAACATCGTCAACTCGAGTTGACGATGTTGTTGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021070.2-3437s1c2
Sequence:CCGGGCAATTCCTTCTGGGACACAACTCGAGTTGTGTCCCAGAAGGAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021070.4-3262s21c1
Sequence:CCGGTGTTGTTCGGGTCGGAGATTTCTCGAGAAATCTCCGACCCGAACAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008520
VALIDATED
LTBP3 MISSION shRNA Bacterial Glycerol Stock
latent transforming growth factor beta binding protein 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008520.2-3768s21c1
Sequence:CCGGGACAGCGTATTGGCTACCAATCTCGAGATTGGTAGCCAATACGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008520.2-2813s21c1
Sequence:CCGGCCGCTACTGTGTTGATGTGAACTCGAGTTCACATCAACACAGTAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008520.2-3202s21c1
Sequence:CCGGCCTGTCGTGATGTCAACGAATCTCGAGATTCGTTGACATCACGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008520.2-3861s21c1
Sequence:CCGGGTCTACAGCTCAGCCGAATTTCTCGAGAAATTCGGCTGAGCTGTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008520.2-4779s21c1
Sequence:CCGGGATCGATCATCGAGGGTATTTCTCGAGAAATACCCTCGATGATCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008520.1-3530s1c1
Sequence:CCGGGCAATTCTTTCTGGGACACAACTCGAGTTGTGTCCCAGAAAGAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008520.1-4096s1c1
Sequence:CCGGCCTTTAATTTACTCTTGGCTTCTCGAGAAGCCAAGAGTAAATTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008520.1-2318s1c1
Sequence:CCGGCCTGTCGTGATGTCAACGAATCTCGAGATTCGTTGACATCACGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008520.1-2884s1c1
Sequence:CCGGGACAGCGTATTGGCTACCAATCTCGAGATTGGTAGCCAATACGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008520.1-1929s1c1
Sequence:CCGGCCGCTACTGTGTTGATGTGAACTCGAGTTCACATCAACACAGTAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008520
VALIDATED
LTBP3 MISSION shRNA shRNA Plasmid DNA
latent transforming growth factor beta binding protein 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008520.2-3768s21c1
Sequence:CCGGGACAGCGTATTGGCTACCAATCTCGAGATTGGTAGCCAATACGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008520.2-2813s21c1
Sequence:CCGGCCGCTACTGTGTTGATGTGAACTCGAGTTCACATCAACACAGTAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008520.2-3202s21c1
Sequence:CCGGCCTGTCGTGATGTCAACGAATCTCGAGATTCGTTGACATCACGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008520.2-3861s21c1
Sequence:CCGGGTCTACAGCTCAGCCGAATTTCTCGAGAAATTCGGCTGAGCTGTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008520.2-4779s21c1
Sequence:CCGGGATCGATCATCGAGGGTATTTCTCGAGAAATACCCTCGATGATCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008520.1-3530s1c1
Sequence:CCGGGCAATTCTTTCTGGGACACAACTCGAGTTGTGTCCCAGAAAGAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008520.1-4096s1c1
Sequence:CCGGCCTTTAATTTACTCTTGGCTTCTCGAGAAGCCAAGAGTAAATTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008520.1-2318s1c1
Sequence:CCGGCCTGTCGTGATGTCAACGAATCTCGAGATTCGTTGACATCACGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008520.1-2884s1c1
Sequence:CCGGGACAGCGTATTGGCTACCAATCTCGAGATTGGTAGCCAATACGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008520.1-1929s1c1
Sequence:CCGGCCGCTACTGTGTTGATGTGAACTCGAGTTCACATCAACACAGTAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008520
VALIDATED
LTBP3 MISSION shRNA Lentiviral Transduction Particles
latent transforming growth factor beta binding protein 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008520.2-3768s21c1
Sequence:CCGGGACAGCGTATTGGCTACCAATCTCGAGATTGGTAGCCAATACGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008520.2-2813s21c1
Sequence:CCGGCCGCTACTGTGTTGATGTGAACTCGAGTTCACATCAACACAGTAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008520.2-3202s21c1
Sequence:CCGGCCTGTCGTGATGTCAACGAATCTCGAGATTCGTTGACATCACGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008520.2-3861s21c1
Sequence:CCGGGTCTACAGCTCAGCCGAATTTCTCGAGAAATTCGGCTGAGCTGTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008520.2-4779s21c1
Sequence:CCGGGATCGATCATCGAGGGTATTTCTCGAGAAATACCCTCGATGATCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008520.1-3530s1c1
Sequence:CCGGGCAATTCTTTCTGGGACACAACTCGAGTTGTGTCCCAGAAAGAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008520.1-4096s1c1
Sequence:CCGGCCTTTAATTTACTCTTGGCTTCTCGAGAAGCCAAGAGTAAATTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008520.1-2318s1c1
Sequence:CCGGCCTGTCGTGATGTCAACGAATCTCGAGATTCGTTGACATCACGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008520.1-2884s1c1
Sequence:CCGGGACAGCGTATTGGCTACCAATCTCGAGATTGGTAGCCAATACGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008520.1-1929s1c1
Sequence:CCGGCCGCTACTGTGTTGATGTGAACTCGAGTTCACATCAACACAGTAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)