EMAIL THIS PAGE TO A FRIEND

LTBP4

latent transforming growth factor beta binding protein 4

108 Gene Product Result for
Synonyms: ARCL1C LTBP-4 LTBP4L LTBP4S
UniProtKB ID: Q8N2S1, O00508, O75412, O75413
Gene ID:
Human(8425) Summary: The protein encoded by this gene binds transforming growth factor beta (TGFB) as it is secreted and targeted to the extracellular matrix. TGFB is biologically latent after secretion and insertion into the extracellular matrix, and sheds TGFB and other proteins upon activation. Defects in this gene may be a cause of cutis laxa and severe pulmonary, gastrointestinal, and urinary abnormalities. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
Mouse(108075) latent transforming growth factor beta binding protein 4
Rat(292734) latent transforming growth factor beta binding protein 4
dog(444849) latent transforming growth factor beta binding protein 4
domestic cat(101088448) latent transforming growth factor beta binding protein 4
cow(100848191) latent transforming growth factor beta binding protein 4
sheep(101120267) latent transforming growth factor beta binding protein 4
naked mole-rat(101699243) latent transforming growth factor beta binding protein 4
domestic guinea pig(100724798) latent transforming growth factor beta binding protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301912 Anti-LTBP4 affinity isolated antibody human
immunohistochemistry pricing
SAB2700009 Anti-LTBP4 (N-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175641 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175641 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175641 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003573 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042544 Rosetta Predictions human pricing
NM_001042545 Rosetta Predictions human pricing
NM_003573 Rosetta Predictions human pricing
XM_001077795 Rosetta Predictions rat pricing
XM_238093 Rosetta Predictions rat pricing
NM_001113549 Rosetta Predictions mouse pricing
NM_175641 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310478 predicted 3829
2 SASI_Hs02_00310479 predicted 1045
3 SASI_Hs02_00310480 predicted 2692
4 SASI_Hs02_00310481 predicted 4271
5 SASI_Hs02_00310482 predicted 1749
6 SASI_Hs02_00310483 predicted 4297
7 SASI_Hs02_00310484 predicted 4692
8 SASI_Hs02_00310485 predicted 3028
9 SASI_Hs02_00310486 predicted 3277
10 SASI_Hs02_00310487 predicted 4298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310488 predicted 3648
2 SASI_Hs02_00310489 predicted 857
3 SASI_Hs02_00310490 predicted 2503
4 SASI_Hs02_00310491 predicted 4088
5 SASI_Hs02_00310492 predicted 1565
6 SASI_Hs02_00310493 predicted 4113
7 SASI_Hs02_00310494 predicted 4503
8 SASI_Hs02_00310495 predicted 2839
9 SASI_Hs02_00310496 predicted 3093
10 SASI_Hs02_00310497 predicted 4121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129137 predicted 3718
2 SASI_Hs01_00129138 predicted 929
3 SASI_Hs01_00129139 predicted 2576
4 SASI_Hs01_00129140 predicted 4157
5 SASI_Hs01_00129141 predicted 1634
6 SASI_Hs01_00129142 predicted 4192
7 SASI_Hs02_00335881 predicted 4575
8 SASI_Hs01_00129143 predicted 2914
9 SASI_Hs01_00129144 predicted 3161
10 SASI_Hs01_00129145 predicted 4185
11 SASI_Hs01_00129136 predicted 4178
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077795 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358562 predicted 3005
2 SASI_Rn02_00358563 predicted 441
3 SASI_Rn02_00358564 predicted 530
4 SASI_Rn02_00358565 predicted 3253
5 SASI_Rn02_00358566 predicted 1339
6 SASI_Rn02_00358567 predicted 1132
7 SASI_Rn02_00358568 predicted 3561
8 SASI_Rn02_00358569 predicted 1634
9 SASI_Rn02_00358570 predicted 3574
10 SASI_Rn02_00358571 predicted 1769
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391216 predicted 3042
2 SASI_Rn02_00391217 predicted 450
3 SASI_Rn02_00391218 predicted 526
4 SASI_Rn02_00391219 predicted 3293
5 SASI_Rn02_00391220 predicted 1338
6 SASI_Rn02_00391221 predicted 1133
7 SASI_Rn02_00391222 predicted 3596
8 SASI_Rn02_00391223 predicted 1631
9 SASI_Rn02_00391224 predicted 3612
10 SASI_Rn02_00391225 predicted 1775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113549 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308133 predicted 3238
2 SASI_Mm02_00308134 predicted 4736
3 SASI_Mm02_00308135 predicted 980
4 SASI_Mm02_00308136 predicted 891
5 SASI_Mm02_00308137 predicted 2997
6 SASI_Mm02_00308138 predicted 880
7 SASI_Mm02_00308139 predicted 2990
8 SASI_Mm02_00308140 predicted 3334
9 SASI_Mm02_00308141 predicted 2667
10 SASI_Mm02_00308142 predicted 3543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175641 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346566 predicted 3440
2 SASI_Mm02_00346567 predicted 4935
3 SASI_Mm01_00063594 predicted 1172
4 SASI_Mm01_00063595 predicted 1082
5 SASI_Mm01_00063596 predicted 3194
6 SASI_Mm01_00063597 predicted 1088
7 SASI_Mm01_00063598 predicted 3196
8 SASI_Mm02_00346568 predicted 3535
9 SASI_Mm01_00063602 predicted 2859
10 SASI_Mm02_00346569 predicted 3741
11 SASI_Mm01_00063593 predicted 4501
12 SASI_Mm01_00063599 predicted 651
13 SASI_Mm01_00063600 predicted 4092
14 SASI_Mm01_00063601 predicted 3422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175641
VALIDATED
LTBP4 MISSION shRNA Bacterial Glycerol Stock
latent transforming growth factor beta binding protein 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175641.1-4514s1c1
Sequence:CCGGCCTATGAATATGGCCCAGATACTCGAGTATCTGGGCCATATTCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175641.1-2747s1c1
Sequence:CCGGGATGTACTGATGTGGATGAATCTCGAGATTCATCCACATCAGTACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175641.1-4436s1c1
Sequence:CCGGCAGATGACTTTGAGGCCCTTTCTCGAGAAAGGGCCTCAAAGTCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175641.1-1379s1c1
Sequence:CCGGCGCTGCCCATTCTTCGAAATACTCGAGTATTTCGAAGAATGGGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175641.1-570s1c1
Sequence:CCGGCCGGGTCCTATGTCCCTTGATCTCGAGATCAAGGGACATAGGACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175641.2-1297s21c1
Sequence:CCGGTCGCTGCCCATTCTTCGAAATCTCGAGATTTCGAAGAATGGGCAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175641.2-629s21c1
Sequence:CCGGGCCTTACCCGCTCCGTTTATACTCGAGTATAAACGGAGCGGGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175641.2-4041s21c1
Sequence:CCGGCAGGCTGGAGTGCGTTGATAACTCGAGTTATCAACGCACTCCAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175641.2-2666s21c1
Sequence:CCGGGATGTACTGATGTGGATGAATCTCGAGATTCATCCACATCAGTACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175641.2-5053s21c1
Sequence:CCGGGCGCCAAATCTCCCACTATACCTCGAGGTATAGTGGGAGATTTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175641
VALIDATED
LTBP4 MISSION shRNA shRNA Plasmid DNA
latent transforming growth factor beta binding protein 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175641.1-4514s1c1
Sequence:CCGGCCTATGAATATGGCCCAGATACTCGAGTATCTGGGCCATATTCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175641.1-2747s1c1
Sequence:CCGGGATGTACTGATGTGGATGAATCTCGAGATTCATCCACATCAGTACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175641.1-4436s1c1
Sequence:CCGGCAGATGACTTTGAGGCCCTTTCTCGAGAAAGGGCCTCAAAGTCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175641.1-1379s1c1
Sequence:CCGGCGCTGCCCATTCTTCGAAATACTCGAGTATTTCGAAGAATGGGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175641.1-570s1c1
Sequence:CCGGCCGGGTCCTATGTCCCTTGATCTCGAGATCAAGGGACATAGGACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175641.2-1297s21c1
Sequence:CCGGTCGCTGCCCATTCTTCGAAATCTCGAGATTTCGAAGAATGGGCAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175641.2-629s21c1
Sequence:CCGGGCCTTACCCGCTCCGTTTATACTCGAGTATAAACGGAGCGGGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175641.2-4041s21c1
Sequence:CCGGCAGGCTGGAGTGCGTTGATAACTCGAGTTATCAACGCACTCCAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175641.2-2666s21c1
Sequence:CCGGGATGTACTGATGTGGATGAATCTCGAGATTCATCCACATCAGTACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175641.2-5053s21c1
Sequence:CCGGGCGCCAAATCTCCCACTATACCTCGAGGTATAGTGGGAGATTTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175641
VALIDATED
LTBP4 MISSION shRNA Lentiviral Transduction Particles
latent transforming growth factor beta binding protein 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175641.1-4514s1c1
Sequence:CCGGCCTATGAATATGGCCCAGATACTCGAGTATCTGGGCCATATTCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175641.1-2747s1c1
Sequence:CCGGGATGTACTGATGTGGATGAATCTCGAGATTCATCCACATCAGTACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175641.1-4436s1c1
Sequence:CCGGCAGATGACTTTGAGGCCCTTTCTCGAGAAAGGGCCTCAAAGTCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175641.1-1379s1c1
Sequence:CCGGCGCTGCCCATTCTTCGAAATACTCGAGTATTTCGAAGAATGGGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175641.1-570s1c1
Sequence:CCGGCCGGGTCCTATGTCCCTTGATCTCGAGATCAAGGGACATAGGACCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175641.2-1297s21c1
Sequence:CCGGTCGCTGCCCATTCTTCGAAATCTCGAGATTTCGAAGAATGGGCAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175641.2-629s21c1
Sequence:CCGGGCCTTACCCGCTCCGTTTATACTCGAGTATAAACGGAGCGGGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175641.2-4041s21c1
Sequence:CCGGCAGGCTGGAGTGCGTTGATAACTCGAGTTATCAACGCACTCCAGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175641.2-2666s21c1
Sequence:CCGGGATGTACTGATGTGGATGAATCTCGAGATTCATCCACATCAGTACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175641.2-5053s21c1
Sequence:CCGGGCGCCAAATCTCCCACTATACCTCGAGGTATAGTGGGAGATTTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003573
LTBP4 MISSION shRNA Bacterial Glycerol Stock
latent transforming growth factor beta binding protein 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003573.1-923s1c1
Sequence:CCGGCAACCGGCTTTGAAAGAGTTACTCGAGTAACTCTTTCAAAGCCGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003573.1-4164s1c1
Sequence:CCGGCCCAGACTTAGGTCCACCTTACTCGAGTAAGGTGGACCTAAGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003573.1-3648s1c1
Sequence:CCGGCGTGGACGAATGTCAGCTCTTCTCGAGAAGAGCTGACATTCGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003573.1-346s1c1
Sequence:CCGGTGTCCCTTGATCTGTCACAATCTCGAGATTGTGACAGATCAAGGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003573.1-1639s1c1
Sequence:CCGGCGATGCATTGATGTGGACGAACTCGAGTTCGTCCACATCAATGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003573.2-3471s21c1
Sequence:CCGGCAACATCCTGGCTCGGAATGTCTCGAGACATTCCGAGCCAGGATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003573.2-1148s21c1
Sequence:CCGGTGCCCATTCTGCGGAACATCACTCGAGTGATGTTCCGCAGAATGGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003573.2-3174s21c1
Sequence:CCGGTGAAACACTACAGGGTGTATGCTCGAGCATACACCCTGTAGTGTTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003573.2-4298s21c1
Sequence:CCGGGCTTCGACATGCCAGACTTTGCTCGAGCAAAGTCTGGCATGTCGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003573
LTBP4 MISSION shRNA shRNA Plasmid DNA
latent transforming growth factor beta binding protein 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003573.1-923s1c1
Sequence:CCGGCAACCGGCTTTGAAAGAGTTACTCGAGTAACTCTTTCAAAGCCGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003573.1-4164s1c1
Sequence:CCGGCCCAGACTTAGGTCCACCTTACTCGAGTAAGGTGGACCTAAGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003573.1-3648s1c1
Sequence:CCGGCGTGGACGAATGTCAGCTCTTCTCGAGAAGAGCTGACATTCGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003573.1-346s1c1
Sequence:CCGGTGTCCCTTGATCTGTCACAATCTCGAGATTGTGACAGATCAAGGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003573.1-1639s1c1
Sequence:CCGGCGATGCATTGATGTGGACGAACTCGAGTTCGTCCACATCAATGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003573.2-3471s21c1
Sequence:CCGGCAACATCCTGGCTCGGAATGTCTCGAGACATTCCGAGCCAGGATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003573.2-1148s21c1
Sequence:CCGGTGCCCATTCTGCGGAACATCACTCGAGTGATGTTCCGCAGAATGGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003573.2-3174s21c1
Sequence:CCGGTGAAACACTACAGGGTGTATGCTCGAGCATACACCCTGTAGTGTTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003573.2-4298s21c1
Sequence:CCGGGCTTCGACATGCCAGACTTTGCTCGAGCAAAGTCTGGCATGTCGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003573
LTBP4 MISSION shRNA Lentiviral Transduction Particles
latent transforming growth factor beta binding protein 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003573.1-923s1c1
Sequence:CCGGCAACCGGCTTTGAAAGAGTTACTCGAGTAACTCTTTCAAAGCCGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003573.1-4164s1c1
Sequence:CCGGCCCAGACTTAGGTCCACCTTACTCGAGTAAGGTGGACCTAAGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003573.1-3648s1c1
Sequence:CCGGCGTGGACGAATGTCAGCTCTTCTCGAGAAGAGCTGACATTCGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003573.1-346s1c1
Sequence:CCGGTGTCCCTTGATCTGTCACAATCTCGAGATTGTGACAGATCAAGGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003573.1-1639s1c1
Sequence:CCGGCGATGCATTGATGTGGACGAACTCGAGTTCGTCCACATCAATGCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003573.2-3471s21c1
Sequence:CCGGCAACATCCTGGCTCGGAATGTCTCGAGACATTCCGAGCCAGGATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003573.2-1148s21c1
Sequence:CCGGTGCCCATTCTGCGGAACATCACTCGAGTGATGTTCCGCAGAATGGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003573.2-3174s21c1
Sequence:CCGGTGAAACACTACAGGGTGTATGCTCGAGCATACACCCTGTAGTGTTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003573.2-4298s21c1
Sequence:CCGGGCTTCGACATGCCAGACTTTGCTCGAGCAAAGTCTGGCATGTCGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)