EMAIL THIS PAGE TO A FRIEND

LTBR

lymphotoxin beta receptor (TNFR superfamily, member 3)

107 Gene Product Result for
Synonyms: CD18 D12S370 LT-BETA-R TNF-R-III TNFCR TNFR-RP TNFR2-RP TNFR3 TNFRSF3
UniProtKB ID: P36941, B7Z1D2, D3DUR2, F5GXE7
Gene ID:
Human(4055) Summary: This gene encodes a member of the tumor necrosis factor receptor superfamily. The major ligands of this receptor include lymphotoxin alpha/beta and tumor necrosis factor ligand superfamily member 14. The encoded protein plays a role in signalling during the development of lymphoid and other organs, lipid metabolism, immune response, and programmed cell death. Activity of this receptor has also been linked to carcinogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2012]
Mouse(17000) lymphotoxin B receptor
Rat(297604) lymphotoxin beta receptor (TNFR superfamily, member 3)
domestic guinea pig(100713613) lymphotoxin beta receptor (TNFR superfamily, member 3)
naked mole-rat(101699564) lymphotoxin beta receptor (TNFR superfamily, member 3)
Domestic Rabbit(100346624) lymphotoxin beta receptor (TNFR superfamily, member 3)
sheep(101114509) lymphotoxin beta receptor (TNFR superfamily, member 3)
dog(486728) lymphotoxin beta receptor (TNFR superfamily, member 3)
cow(504653) lymphotoxin beta receptor (TNFR superfamily, member 3)
domestic cat(101081146) lymphotoxin beta receptor (TNFR superfamily, member 3)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010736 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010736 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010736 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002342 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002342 siRNAs that have been validated in the lab human pricing
NM_001008315 Rosetta Predictions rat pricing
NM_010736 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002342 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109207 validated 364
2 SASI_Hs02_00333663 predicted 635
3 SASI_Hs01_00109205 predicted 1224
4 SASI_Hs01_00109206 predicted 477
5 SASI_Hs02_00333664 predicted 1454
6 SASI_Hs01_00109208 predicted 409
7 SASI_Hs01_00109209 predicted 579
8 SASI_Hs01_00109211 predicted 421
9 SASI_Hs01_00109212 predicted 1586
10 SASI_Hs01_00109213 predicted 1904
11 SASI_Hs01_00109214 predicted 325
12 SASI_Hs01_00109210 predicted 1450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008315 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120155 predicted 382
2 SASI_Rn01_00120157 predicted 439
3 SASI_Rn01_00120158 predicted 420
4 SASI_Rn01_00120159 predicted 226
5 SASI_Rn01_00120160 predicted 412
6 SASI_Rn01_00120161 predicted 1453
7 SASI_Rn01_00120162 predicted 602
8 SASI_Rn01_00120163 predicted 590
9 SASI_Rn01_00120164 predicted 1237
10 SASI_Rn02_00199051 predicted 997
11 SASI_Rn01_00120156 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319239 predicted 400
2 SASI_Mm01_00115248 predicted 1574
3 SASI_Mm01_00115249 predicted 1219
4 SASI_Mm01_00115250 predicted 802
5 SASI_Mm01_00115251 predicted 377
6 SASI_Mm01_00115252 predicted 1587
7 SASI_Mm01_00115253 predicted 789
8 SASI_Mm01_00115255 predicted 583
9 SASI_Mm01_00115256 predicted 602
10 SASI_Mm01_00115257 predicted 1820
11 SASI_Mm01_00115254 predicted 1390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010736
VALIDATED
LTBR MISSION shRNA Bacterial Glycerol Stock
lymphotoxin beta receptor (TNFR superfamily, member 3)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010736.3-379s21c1
Sequence:CCGGGCGAGTTTGTCTTTGCGGTATCTCGAGATACCGCAAAGACAAACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010736.3-1232s21c1
Sequence:CCGGCACCGGCAACATCTACATATACTCGAGTATATGTAGATGTTGCCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010736.3-803s21c1
Sequence:CCGGCTACTCGGATACCATCTGTAACTCGAGTTACAGATGGTATCCGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010736.1-1540s1c1
Sequence:CCGGGCTCTGAGAAATAGAGCCCTACTCGAGTAGGGCTCTATTTCTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010736.1-1216s1c1
Sequence:CCGGCACCGGCAACATCTACATATACTCGAGTATATGTAGATGTTGCCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010736.1-787s1c1
Sequence:CCGGCTACTCGGATACCATCTGTAACTCGAGTTACAGATGGTATCCGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010736.1-635s1c1
Sequence:CCGGGCCGAGGTCACAGATGAAATTCTCGAGAATTTCATCTGTGACCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010736.3-651s21c1
Sequence:CCGGGCCGAGGTCACAGATGAAATTCTCGAGAATTTCATCTGTGACCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010736.1-363s1c1
Sequence:CCGGGCGAGTTTGTCTTTGCGGTATCTCGAGATACCGCAAAGACAAACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010736
VALIDATED
LTBR MISSION shRNA shRNA Plasmid DNA
lymphotoxin beta receptor (TNFR superfamily, member 3)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010736.3-379s21c1
Sequence:CCGGGCGAGTTTGTCTTTGCGGTATCTCGAGATACCGCAAAGACAAACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010736.3-1232s21c1
Sequence:CCGGCACCGGCAACATCTACATATACTCGAGTATATGTAGATGTTGCCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010736.3-803s21c1
Sequence:CCGGCTACTCGGATACCATCTGTAACTCGAGTTACAGATGGTATCCGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010736.1-1540s1c1
Sequence:CCGGGCTCTGAGAAATAGAGCCCTACTCGAGTAGGGCTCTATTTCTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010736.1-1216s1c1
Sequence:CCGGCACCGGCAACATCTACATATACTCGAGTATATGTAGATGTTGCCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010736.1-787s1c1
Sequence:CCGGCTACTCGGATACCATCTGTAACTCGAGTTACAGATGGTATCCGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010736.1-635s1c1
Sequence:CCGGGCCGAGGTCACAGATGAAATTCTCGAGAATTTCATCTGTGACCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010736.3-651s21c1
Sequence:CCGGGCCGAGGTCACAGATGAAATTCTCGAGAATTTCATCTGTGACCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010736.1-363s1c1
Sequence:CCGGGCGAGTTTGTCTTTGCGGTATCTCGAGATACCGCAAAGACAAACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010736
VALIDATED
LTBR MISSION shRNA Lentiviral Transduction Particles
lymphotoxin beta receptor (TNFR superfamily, member 3)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010736.3-379s21c1
Sequence:CCGGGCGAGTTTGTCTTTGCGGTATCTCGAGATACCGCAAAGACAAACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010736.3-1232s21c1
Sequence:CCGGCACCGGCAACATCTACATATACTCGAGTATATGTAGATGTTGCCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010736.3-803s21c1
Sequence:CCGGCTACTCGGATACCATCTGTAACTCGAGTTACAGATGGTATCCGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010736.1-1540s1c1
Sequence:CCGGGCTCTGAGAAATAGAGCCCTACTCGAGTAGGGCTCTATTTCTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010736.1-1216s1c1
Sequence:CCGGCACCGGCAACATCTACATATACTCGAGTATATGTAGATGTTGCCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010736.1-787s1c1
Sequence:CCGGCTACTCGGATACCATCTGTAACTCGAGTTACAGATGGTATCCGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010736.1-635s1c1
Sequence:CCGGGCCGAGGTCACAGATGAAATTCTCGAGAATTTCATCTGTGACCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010736.3-651s21c1
Sequence:CCGGGCCGAGGTCACAGATGAAATTCTCGAGAATTTCATCTGTGACCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010736.1-363s1c1
Sequence:CCGGGCGAGTTTGTCTTTGCGGTATCTCGAGATACCGCAAAGACAAACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002342
VALIDATED
LTBR MISSION shRNA Bacterial Glycerol Stock
lymphotoxin beta receptor (TNFR superfamily, member 3)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002342.1-1452s21c1
Sequence:CCGGGAACCAATTTATCACCCATGACTCGAGTCATGGGTGATAAATTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002342.1-585s21c1
Sequence:CCGGTACACACTGCGAGCTACTTTCCTCGAGGAAAGTAGCTCGCAGTGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002342.1-1040s21c1
Sequence:CCGGTACAGCCACTGCTACCCATTTCTCGAGAAATGGGTAGCAGTGGCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002342.1-363s21c1
Sequence:CCGGCACCTATGTCTCAGCTAAATGCTCGAGCATTTAGCTGAGACATAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002342.1-1017s1c1
Sequence:CCGGCCATCCATACTTCCCTGACTTCTCGAGAAGTCAGGGAAGTATGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002342.1-1227s1c1
Sequence:CCGGGTCTATGACTATCACTGGCAACTCGAGTTGCCAGTGATAGTCATAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002342.1-1452s1c1
Sequence:CCGGGAACCAATTTATCACCCATGACTCGAGTCATGGGTGATAAATTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002342.1-267s1c1
Sequence:CCGGGCCTCCATATGCGTCGGAGAACTCGAGTTCTCCGACGCATATGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002342.1-372s1c1
Sequence:CCGGCTCAGCTAAATGTAGCCGCATCTCGAGATGCGGCTACATTTAGCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002342.1-1921s21c1
Sequence:CCGGCTGCATGAAGATGAAATTATACTCGAGTATAATTTCATCTTCATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002342
VALIDATED
LTBR MISSION shRNA shRNA Plasmid DNA
lymphotoxin beta receptor (TNFR superfamily, member 3)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002342.1-1452s21c1
Sequence:CCGGGAACCAATTTATCACCCATGACTCGAGTCATGGGTGATAAATTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002342.1-585s21c1
Sequence:CCGGTACACACTGCGAGCTACTTTCCTCGAGGAAAGTAGCTCGCAGTGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002342.1-1040s21c1
Sequence:CCGGTACAGCCACTGCTACCCATTTCTCGAGAAATGGGTAGCAGTGGCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002342.1-363s21c1
Sequence:CCGGCACCTATGTCTCAGCTAAATGCTCGAGCATTTAGCTGAGACATAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002342.1-1017s1c1
Sequence:CCGGCCATCCATACTTCCCTGACTTCTCGAGAAGTCAGGGAAGTATGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002342.1-1227s1c1
Sequence:CCGGGTCTATGACTATCACTGGCAACTCGAGTTGCCAGTGATAGTCATAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002342.1-1452s1c1
Sequence:CCGGGAACCAATTTATCACCCATGACTCGAGTCATGGGTGATAAATTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002342.1-267s1c1
Sequence:CCGGGCCTCCATATGCGTCGGAGAACTCGAGTTCTCCGACGCATATGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002342.1-372s1c1
Sequence:CCGGCTCAGCTAAATGTAGCCGCATCTCGAGATGCGGCTACATTTAGCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002342.1-1921s21c1
Sequence:CCGGCTGCATGAAGATGAAATTATACTCGAGTATAATTTCATCTTCATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002342
VALIDATED
LTBR MISSION shRNA Lentiviral Transduction Particles
lymphotoxin beta receptor (TNFR superfamily, member 3)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002342.1-1452s21c1
Sequence:CCGGGAACCAATTTATCACCCATGACTCGAGTCATGGGTGATAAATTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002342.1-585s21c1
Sequence:CCGGTACACACTGCGAGCTACTTTCCTCGAGGAAAGTAGCTCGCAGTGTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002342.1-1040s21c1
Sequence:CCGGTACAGCCACTGCTACCCATTTCTCGAGAAATGGGTAGCAGTGGCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002342.1-363s21c1
Sequence:CCGGCACCTATGTCTCAGCTAAATGCTCGAGCATTTAGCTGAGACATAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002342.1-1017s1c1
Sequence:CCGGCCATCCATACTTCCCTGACTTCTCGAGAAGTCAGGGAAGTATGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002342.1-1227s1c1
Sequence:CCGGGTCTATGACTATCACTGGCAACTCGAGTTGCCAGTGATAGTCATAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002342.1-1452s1c1
Sequence:CCGGGAACCAATTTATCACCCATGACTCGAGTCATGGGTGATAAATTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002342.1-267s1c1
Sequence:CCGGGCCTCCATATGCGTCGGAGAACTCGAGTTCTCCGACGCATATGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002342.1-372s1c1
Sequence:CCGGCTCAGCTAAATGTAGCCGCATCTCGAGATGCGGCTACATTTAGCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002342.1-1921s21c1
Sequence:CCGGCTGCATGAAGATGAAATTATACTCGAGTATAATTTCATCTTCATGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)