EMAIL THIS PAGE TO A FRIEND

LTC4S

leukotriene C4 synthase

44 Gene Product Result for
UniProtKB ID: Q16873, Q8N6P0, Q9UC73, Q9UD18
Gene ID:
Human(4056) Summary: The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family includes a number of human proteins, several of which are involved the production of leukotrienes. This gene encodes an enzyme that catalyzes the first step in the biosynthesis of cysteinyl leukotrienes, potent biological compounds derived from arachidonic acid. Leukotrienes have been implicated as mediators of anaphylaxis and inflammatory conditions such as human bronchial asthma. This protein localizes to the nuclear envelope and adjacent endoplasmic reticulum. [provided by RefSeq, Jul 2008]
Mouse(17001) leukotriene C4 synthase
Rat(114097) leukotriene C4 synthase
Zebrafish(100535432) leukotriene C4 synthase
cow(511749) leukotriene C4 synthase
domestic cat(101096198) leukotriene C4 synthase
dog(607316) leukotriene C4 synthase
chicken(770665) leukotriene C4 synthase
sheep(101119304) leukotriene C4 synthase
naked mole-rat(101722474) leukotriene C4 synthase
domestic guinea pig(100725689) leukotriene C4 synthase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100265 Anti-LTC4S (37-48) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV49035 Anti-LTC4S antibody produced in rabbit IgG fraction of antiserum , bovine, human, mouse, canine, guinea pig, horse, rabbit, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008521 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008521 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008521 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000897 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000897 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000897 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145867 Rosetta Predictions human pricing
NM_053639 Rosetta Predictions rat pricing
NM_008521 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184982 predicted 260
2 SASI_Hs01_00184983 predicted 302
3 SASI_Hs01_00184984 predicted 297
4 SASI_Hs01_00184985 predicted 297
5 SASI_Hs01_00184986 predicted 331
6 SASI_Hs01_00184987 predicted 249
7 SASI_Hs01_00184988 predicted 260
8 SASI_Hs01_00184989 predicted 214
9 SASI_Hs01_00184990 predicted 302
10 SASI_Hs01_00184991 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053639 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045331 predicted 254
2 SASI_Rn01_00045332 predicted 227
3 SASI_Rn01_00045333 predicted 201
4 SASI_Rn02_00266361 predicted 259
5 SASI_Rn01_00045334 predicted 229
6 SASI_Rn01_00045335 predicted 227
7 SASI_Rn01_00045336 predicted 202
8 SASI_Rn02_00266362 predicted 253
9 SASI_Rn01_00045337 predicted 258
10 SASI_Rn01_00045338 predicted 216
11 SASI_Rn01_00045330 predicted 219
12 SASI_Rn01_00045339 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008521 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061356 predicted 201
2 SASI_Mm01_00061357 predicted 269
3 SASI_Mm01_00061358 predicted 242
4 SASI_Mm01_00061359 predicted 266
5 SASI_Mm01_00061360 predicted 262
6 SASI_Mm01_00061361 predicted 232
7 SASI_Mm01_00061362 predicted 266
8 SASI_Mm01_00061363 predicted 293
9 SASI_Mm01_00061364 predicted 324
10 SASI_Mm02_00314101 predicted 236
11 SASI_Mm01_00061365 predicted 278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008521
LTC4S MISSION shRNA Bacterial Glycerol Stock
leukotriene C4 synthase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008521.1-305s1c1
Sequence:CCGGGCCTCCGCTATTTCCAGGGATCTCGAGATCCCTGGAAATAGCGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008521.1-192s1c1
Sequence:CCGGCCAGGTAAACTGCAGCGAGTACTCGAGTACTCGCTGCAGTTTACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008521.1-270s1c1
Sequence:CCGGCGCAGCCCTGTGCGGACTGTTCTCGAGAACAGTCCGCACAGGGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008521.1-81s1c1
Sequence:CCGGAGTTCTGTTGCAAGCCTACTTCTCGAGAAGTAGGCTTGCAACAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008521.1-244s1c1
Sequence:CCGGGCCGGCATCTTCTTCCACGAACTCGAGTTCGTGGAAGAAGATGCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008521
LTC4S MISSION shRNA shRNA Plasmid DNA
leukotriene C4 synthase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008521.1-305s1c1
Sequence:CCGGGCCTCCGCTATTTCCAGGGATCTCGAGATCCCTGGAAATAGCGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008521.1-192s1c1
Sequence:CCGGCCAGGTAAACTGCAGCGAGTACTCGAGTACTCGCTGCAGTTTACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008521.1-270s1c1
Sequence:CCGGCGCAGCCCTGTGCGGACTGTTCTCGAGAACAGTCCGCACAGGGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008521.1-81s1c1
Sequence:CCGGAGTTCTGTTGCAAGCCTACTTCTCGAGAAGTAGGCTTGCAACAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008521.1-244s1c1
Sequence:CCGGGCCGGCATCTTCTTCCACGAACTCGAGTTCGTGGAAGAAGATGCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008521
LTC4S MISSION shRNA Lentiviral Transduction Particles
leukotriene C4 synthase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008521.1-305s1c1
Sequence:CCGGGCCTCCGCTATTTCCAGGGATCTCGAGATCCCTGGAAATAGCGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008521.1-192s1c1
Sequence:CCGGCCAGGTAAACTGCAGCGAGTACTCGAGTACTCGCTGCAGTTTACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008521.1-270s1c1
Sequence:CCGGCGCAGCCCTGTGCGGACTGTTCTCGAGAACAGTCCGCACAGGGCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008521.1-81s1c1
Sequence:CCGGAGTTCTGTTGCAAGCCTACTTCTCGAGAAGTAGGCTTGCAACAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008521.1-244s1c1
Sequence:CCGGGCCGGCATCTTCTTCCACGAACTCGAGTTCGTGGAAGAAGATGCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000897
LTC4S MISSION shRNA Bacterial Glycerol Stock
leukotriene C4 synthase
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000045543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000897.2-150s1c1
Sequence:CCGGGCAAGCCTACTTCTCCCTGCACTCGAGTGCAGGGAGAAGTAGGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000897.2-224s1c1
Sequence:CCGGCACCCGAGTTCGAGCGCGTCTCTCGAGAGACGCGCTCGAACTCGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000897.2-225s1c1
Sequence:CCGGACCCGAGTTCGAGCGCGTCTACTCGAGTAGACGCGCTCGAACTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000897.2-143s1c1
Sequence:CCGGTCCTGCTGCAAGCCTACTTCTCTCGAGAGAAGTAGGCTTGCAGCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000897
LTC4S MISSION shRNA shRNA Plasmid DNA
leukotriene C4 synthase
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000045543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000897.2-150s1c1
Sequence:CCGGGCAAGCCTACTTCTCCCTGCACTCGAGTGCAGGGAGAAGTAGGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000897.2-224s1c1
Sequence:CCGGCACCCGAGTTCGAGCGCGTCTCTCGAGAGACGCGCTCGAACTCGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000897.2-225s1c1
Sequence:CCGGACCCGAGTTCGAGCGCGTCTACTCGAGTAGACGCGCTCGAACTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000897.2-143s1c1
Sequence:CCGGTCCTGCTGCAAGCCTACTTCTCTCGAGAGAAGTAGGCTTGCAGCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000897
LTC4S MISSION shRNA Lentiviral Transduction Particles
leukotriene C4 synthase
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000045543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000897.2-150s1c1
Sequence:CCGGGCAAGCCTACTTCTCCCTGCACTCGAGTGCAGGGAGAAGTAGGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000897.2-224s1c1
Sequence:CCGGCACCCGAGTTCGAGCGCGTCTCTCGAGAGACGCGCTCGAACTCGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000897.2-225s1c1
Sequence:CCGGACCCGAGTTCGAGCGCGTCTACTCGAGTAGACGCGCTCGAACTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000897.2-143s1c1
Sequence:CCGGTCCTGCTGCAAGCCTACTTCTCTCGAGAGAAGTAGGCTTGCAGCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)