EMAIL THIS PAGE TO A FRIEND

LTF

lactotransferrin

65 Gene Product Result for
Synonyms: GIG12 HLF2 LF
Gene ID:
Human(4057) Summary: This gene is a member of the transferrin family of genes and its protein product is found in the secondary granules of neutrophils. The protein is a major iron-binding protein in milk and body secretions with an antimicrobial activity, making it an important component of the non-specific immune system. The protein demonstrates a broad spectrum of properties, including regulation of iron homeostasis, host defense against a broad range of microbial infections, anti-inflammatory activity, regulation of cellular growth and differentiation and protection against cancer development and metastasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Mouse(17002) lactotransferrin
Rat(301034) lactotransferrin
cow(280846) lactotransferrin
Horse(100033944) lactotransferrin
dog(484787) lactotransferrin
domestic cat(101093504) lactotransferrin
naked mole-rat(101722340) lactotransferrin
Goat(100861194) lactotransferrin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0705 Human LTF / Lactotransferrin ELISA Kit human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0729 AQUA Peptide CGLVPVLAENYD[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002343 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008522 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008522 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008522 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030121 MISSION® esiRNA esiRNA human LTF (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002343 Rosetta Predictions human pricing
NM_001106864 Rosetta Predictions rat pricing
NM_008522 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084519 predicted 1412
2 SASI_Hs01_00084520 predicted 1591
3 SASI_Hs01_00084521 predicted 1355
4 SASI_Hs01_00084522 predicted 222
5 SASI_Hs01_00084523 predicted 1417
6 SASI_Hs02_00333665 predicted 757
7 SASI_Hs01_00084525 predicted 1372
8 SASI_Hs01_00084526 predicted 922
9 SASI_Hs02_00333666 predicted 1322
10 SASI_Hs01_00084527 predicted 1370
11 SASI_Hs01_00084524 predicted 1539
12 SASI_Hs01_00084528 predicted 1783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223156 predicted 258
2 SASI_Rn02_00223157 predicted 1021
3 SASI_Rn02_00223158 predicted 1593
4 SASI_Rn02_00223159 predicted 730
5 SASI_Rn02_00223160 predicted 487
6 SASI_Rn02_00223161 predicted 1262
7 SASI_Rn02_00223162 predicted 1754
8 SASI_Rn02_00223163 predicted 2243
9 SASI_Rn02_00223164 predicted 1027
10 SASI_Rn02_00223165 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042165 predicted 1345
2 SASI_Mm01_00042166 predicted 269
3 SASI_Mm01_00042167 predicted 255
4 SASI_Mm01_00042168 predicted 849
5 SASI_Mm01_00042170 predicted 977
6 SASI_Mm02_00314102 predicted 1769
7 SASI_Mm02_00314103 predicted 1584
8 SASI_Mm01_00042171 predicted 1063
9 SASI_Mm01_00042172 predicted 1593
10 SASI_Mm01_00042174 predicted 738
11 SASI_Mm01_00042169 predicted 662
12 SASI_Mm01_00042173 predicted 1886
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002343
LTF MISSION shRNA Bacterial Glycerol Stock
lactotransferrin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002343.1-1333s1c1
Sequence:CCGGGCCATCCAGAACTTGAGGAAACTCGAGTTTCCTCAAGTTCTGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002343.1-1621s1c1
Sequence:CCGGCCTGATCCTAACTGTGTGGATCTCGAGATCCACACAGTTAGGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002343.1-2359s1c1
Sequence:CCGGGCAGGCATTACTAATCTGAAACTCGAGTTTCAGATTAGTAATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002343.1-831s1c1
Sequence:CCGGCGGTGCAGATAAAGGACAGTTCTCGAGAACTGTCCTTTATCTGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002343.1-565s1c1
Sequence:CCGGCCCTACAAACTGCGACCTGTACTCGAGTACAGGTCGCAGTTTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002343.2-1650s21c1
Sequence:CCGGCCCAACAGCAACGAGAGATACCTCGAGGTATCTCTCGTTGCTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002343.2-354s21c1
Sequence:CCGGCAGCCACGAACTCACTATTATCTCGAGATAATAGTGAGTTCGTGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002343.2-1581s21c1
Sequence:CCGGGGGTCTGACCCGAGATCTAATCTCGAGATTAGATCTCGGGTCAGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002343
LTF MISSION shRNA shRNA Plasmid DNA
lactotransferrin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002343.1-1333s1c1
Sequence:CCGGGCCATCCAGAACTTGAGGAAACTCGAGTTTCCTCAAGTTCTGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002343.1-1621s1c1
Sequence:CCGGCCTGATCCTAACTGTGTGGATCTCGAGATCCACACAGTTAGGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002343.1-2359s1c1
Sequence:CCGGGCAGGCATTACTAATCTGAAACTCGAGTTTCAGATTAGTAATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002343.1-831s1c1
Sequence:CCGGCGGTGCAGATAAAGGACAGTTCTCGAGAACTGTCCTTTATCTGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002343.1-565s1c1
Sequence:CCGGCCCTACAAACTGCGACCTGTACTCGAGTACAGGTCGCAGTTTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002343.2-1650s21c1
Sequence:CCGGCCCAACAGCAACGAGAGATACCTCGAGGTATCTCTCGTTGCTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002343.2-354s21c1
Sequence:CCGGCAGCCACGAACTCACTATTATCTCGAGATAATAGTGAGTTCGTGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002343.2-1581s21c1
Sequence:CCGGGGGTCTGACCCGAGATCTAATCTCGAGATTAGATCTCGGGTCAGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002343
LTF MISSION shRNA Lentiviral Transduction Particles
lactotransferrin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002343.1-1333s1c1
Sequence:CCGGGCCATCCAGAACTTGAGGAAACTCGAGTTTCCTCAAGTTCTGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002343.1-1621s1c1
Sequence:CCGGCCTGATCCTAACTGTGTGGATCTCGAGATCCACACAGTTAGGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002343.1-2359s1c1
Sequence:CCGGGCAGGCATTACTAATCTGAAACTCGAGTTTCAGATTAGTAATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002343.1-831s1c1
Sequence:CCGGCGGTGCAGATAAAGGACAGTTCTCGAGAACTGTCCTTTATCTGCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002343.1-565s1c1
Sequence:CCGGCCCTACAAACTGCGACCTGTACTCGAGTACAGGTCGCAGTTTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002343.2-1650s21c1
Sequence:CCGGCCCAACAGCAACGAGAGATACCTCGAGGTATCTCTCGTTGCTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002343.2-354s21c1
Sequence:CCGGCAGCCACGAACTCACTATTATCTCGAGATAATAGTGAGTTCGTGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002343.2-1581s21c1
Sequence:CCGGGGGTCTGACCCGAGATCTAATCTCGAGATTAGATCTCGGGTCAGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008522
LTF MISSION shRNA Bacterial Glycerol Stock
lactotransferrin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008522.2-117s1c1
Sequence:CCGGGCTGTGTCAAATTCTGAGGAACTCGAGTTCCTCAGAATTTGACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008522.2-1932s1c1
Sequence:CCGGCAGGTTCAGTTTGGGAGAAATCTCGAGATTTCTCCCAAACTGAACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008522.2-486s1c1
Sequence:CCGGCGTCCATACCTGAATTGGAATCTCGAGATTCCAATTCAGGTATGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008522.2-1736s1c1
Sequence:CCGGGCAGAATACTGACGGGAAGAACTCGAGTTCTTCCCGTCAGTATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008522.2-727s1c1
Sequence:CCGGCGGTATTTGAGGAGTTACCAACTCGAGTTGGTAACTCCTCAAATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008522
LTF MISSION shRNA shRNA Plasmid DNA
lactotransferrin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008522.2-117s1c1
Sequence:CCGGGCTGTGTCAAATTCTGAGGAACTCGAGTTCCTCAGAATTTGACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008522.2-1932s1c1
Sequence:CCGGCAGGTTCAGTTTGGGAGAAATCTCGAGATTTCTCCCAAACTGAACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008522.2-486s1c1
Sequence:CCGGCGTCCATACCTGAATTGGAATCTCGAGATTCCAATTCAGGTATGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008522.2-1736s1c1
Sequence:CCGGGCAGAATACTGACGGGAAGAACTCGAGTTCTTCCCGTCAGTATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008522.2-727s1c1
Sequence:CCGGCGGTATTTGAGGAGTTACCAACTCGAGTTGGTAACTCCTCAAATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008522
LTF MISSION shRNA Lentiviral Transduction Particles
lactotransferrin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008522.2-117s1c1
Sequence:CCGGGCTGTGTCAAATTCTGAGGAACTCGAGTTCCTCAGAATTTGACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008522.2-1932s1c1
Sequence:CCGGCAGGTTCAGTTTGGGAGAAATCTCGAGATTTCTCCCAAACTGAACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008522.2-486s1c1
Sequence:CCGGCGTCCATACCTGAATTGGAATCTCGAGATTCCAATTCAGGTATGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008522.2-1736s1c1
Sequence:CCGGGCAGAATACTGACGGGAAGAACTCGAGTTCTTCCCGTCAGTATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008522.2-727s1c1
Sequence:CCGGCGGTATTTGAGGAGTTACCAACTCGAGTTGGTAACTCCTCAAATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)