EMAIL THIS PAGE TO A FRIEND

LTK

leukocyte receptor tyrosine kinase

119 Gene Product Result for
Synonyms: TYK1
UniProtKB ID: P29376, A6NNJ8, B4DL89, E9PFX4
Gene ID:
Human(4058) Summary: The protein encoded by this gene is a member of the ros/insulin receptor family of tyrosine kinases. Tyrosine-specific phosphorylation of proteins is a key to the control of diverse pathways leading to cell growth and differentiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(17005) leukocyte tyrosine kinase
Rat(311337) leukocyte receptor tyrosine kinase
Zebrafish(564470) leukocyte tyrosine kinase
chicken(423216) leukocyte receptor tyrosine kinase
cow(788253) leukocyte receptor tyrosine kinase
domestic cat(101084113) leukocyte receptor tyrosine kinase
dog(100688547) leukocyte receptor tyrosine kinase
sheep(101115880) leukocyte receptor tyrosine kinase
naked mole-rat(101715763) leukocyte receptor tyrosine kinase
Domestic Rabbit(100343076) leukocyte receptor tyrosine kinase
domestic guinea pig(100733438) leukocyte receptor tyrosine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0975 Phosphotyrosine LTK / Leukocyte Tyrosine Kinase Receptor ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002344 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002344 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002344 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_206941 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_206941 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_206941 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU161121 MISSION® esiRNA esiRNA human LTK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002344 Rosetta Predictions human pricing
NM_206961 Rosetta Predictions human pricing
NM_001107763 Rosetta Predictions rat pricing
NM_008523 Rosetta Predictions mouse pricing
NM_203345 Rosetta Predictions mouse pricing
NM_206941 Rosetta Predictions mouse pricing
NM_206942 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333667 predicted 2674
2 SASI_Hs01_00032929 predicted 1982
3 SASI_Hs01_00032930 predicted 2161
4 SASI_Hs02_00333668 predicted 1804
5 SASI_Hs01_00032931 predicted 3135
6 SASI_Hs01_00032933 predicted 3017
7 SASI_Hs01_00032934 predicted 2210
8 SASI_Hs01_00032935 predicted 2576
9 SASI_Hs01_00032936 predicted 2160
10 SASI_Hs01_00032937 predicted 2106
11 SASI_Hs01_00032932 predicted 2028
12 SASI_Hs01_00032938 predicted 1582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373660 predicted 2496
2 SASI_Hs01_00207953 predicted 1797
3 SASI_Hs01_00207954 predicted 1974
4 SASI_Hs02_00373661 predicted 1620
5 SASI_Hs01_00207955 predicted 2952
6 SASI_Hs01_00207957 predicted 2830
7 SASI_Hs01_00207958 predicted 2031
8 SASI_Hs01_00207959 predicted 2395
9 SASI_Hs01_00207960 predicted 1972
10 SASI_Hs01_00207961 predicted 1928
11 SASI_Hs01_00207956 predicted 1853
12 SASI_Hs01_00207962 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232025 predicted 1194
2 SASI_Rn02_00232026 predicted 1468
3 SASI_Rn02_00232027 predicted 1071
4 SASI_Rn02_00232028 predicted 686
5 SASI_Rn02_00232029 predicted 1826
6 SASI_Rn02_00232030 predicted 1733
7 SASI_Rn02_00232031 predicted 1886
8 SASI_Rn02_00232032 predicted 1574
9 SASI_Rn02_00232033 predicted 1584
10 SASI_Rn02_00232034 predicted 1466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078264 predicted 493
2 SASI_Mm01_00078265 predicted 1198
3 SASI_Mm01_00078266 predicted 1704
4 SASI_Mm02_00314104 predicted 588
5 SASI_Mm01_00078267 predicted 1454
6 SASI_Mm01_00078268 predicted 1825
7 SASI_Mm01_00078269 predicted 554
8 SASI_Mm02_00314105 predicted 607
9 SASI_Mm01_00078271 predicted 1099
10 SASI_Mm02_00314106 predicted 799
11 SASI_Mm01_00078270 predicted 612
12 SASI_Mm01_00078272 predicted 1306
13 SASI_Mm01_00078273 predicted 1927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203345 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067034 predicted 1338
2 SASI_Mm01_00067035 predicted 2044
3 SASI_Mm01_00067036 predicted 2550
4 SASI_Mm02_00351764 predicted 1428
5 SASI_Mm01_00067037 predicted 2301
6 SASI_Mm01_00067038 predicted 2669
7 SASI_Mm01_00067039 predicted 1399
8 SASI_Mm02_00351765 predicted 1451
9 SASI_Mm01_00067041 predicted 1950
10 SASI_Mm02_00351766 predicted 1639
11 SASI_Mm01_00067040 predicted 1455
12 SASI_Mm01_00067042 predicted 2143
13 SASI_Mm01_00067043 predicted 2778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206941 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023277 predicted 676
2 SASI_Mm01_00023278 predicted 1383
3 SASI_Mm01_00023279 predicted 1883
4 SASI_Mm02_00351841 predicted 767
5 SASI_Mm01_00023280 predicted 1643
6 SASI_Mm01_00023281 predicted 2007
7 SASI_Mm01_00023282 predicted 739
8 SASI_Mm02_00351842 predicted 787
9 SASI_Mm01_00023284 predicted 1286
10 SASI_Mm02_00351843 predicted 978
11 SASI_Mm01_00023283 predicted 797
12 SASI_Mm01_00023285 predicted 1481
13 SASI_Mm01_00023286 predicted 2106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146320 predicted 1160
2 SASI_Mm01_00146321 predicted 1857
3 SASI_Mm01_00146322 predicted 2368
4 SASI_Mm02_00351844 predicted 1247
5 SASI_Mm01_00146323 predicted 2118
6 SASI_Mm01_00146324 predicted 2492
7 SASI_Mm01_00146325 predicted 1210
8 SASI_Mm02_00351845 predicted 1264
9 SASI_Mm01_00146327 predicted 1764
10 SASI_Mm02_00351846 predicted 1456
11 SASI_Mm01_00146326 predicted 1281
12 SASI_Mm01_00146328 predicted 1959
13 SASI_Mm01_00146329 predicted 2596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002344
LTK MISSION shRNA Bacterial Glycerol Stock
leukocyte receptor tyrosine kinase
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002344.5-1480s21c1
Sequence:GTACCGGCTCAACACTGAGCCTCCTTATCTCGAGATAAGGAGGCTCAGTGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002344.3-2599s1c1
Sequence:CCGGGATCTTTGGAGTGCCTAAGACCTCGAGGTCTTAGGCACTCCAAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002344.3-2921s1c1
Sequence:CCGGCTTGCCATGCTGGAAACCAGCCTCGAGGCTGGTTTCCAGCATGGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002344.4-2292s21c1
Sequence:CCGGAGTTTCGCCATCAGAACATTGCTCGAGCAATGTTCTGATGGCGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002344.4-3221s21c1
Sequence:CCGGACTGAGGGTCCCTCCCTATACCTCGAGGTATAGGGAGGGACCCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002344.4-2585s21c1
Sequence:CCGGTTTGGGATGGCACGAGATATCCTCGAGGATATCTCGTGCCATCCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002344.4-2504s21c1
Sequence:CCGGCACTTCATCCACAGGGATATTCTCGAGAATATCCCTGTGGATGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002344.4-2163s21c1
Sequence:CCGGTGTATGAGGGACTGGTAATTGCTCGAGCAATTACCAGTCCCTCATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002344.x-1509s1c1
Sequence:CCGGGCCAATGTTACTCTGCTCAGACTCGAGTCTGAGCAGAGTAACATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002344.x-593s1c1
Sequence:CCGGCGTCTTCGTCTCAGCAATCTTCTCGAGAAGATTGCTGAGACGAAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002344.5-603s21c1
Sequence:GTACCGGTCTTCGTCTCAGCAATCTTCTCTCGAGAGAAGATTGCTGAGACGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002344.x-1979s1c1
Sequence:CCGGCTTTGGGATGGCACGAGATATCTCGAGATATCTCGTGCCATCCCAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002344.x-2132s1c1
Sequence:CCGGGATCTTCTCACTGGGCTACATCTCGAGATGTAGCCCAGTGAGAAGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002344
LTK MISSION shRNA shRNA Plasmid DNA
leukocyte receptor tyrosine kinase
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002344.5-1480s21c1
Sequence:GTACCGGCTCAACACTGAGCCTCCTTATCTCGAGATAAGGAGGCTCAGTGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002344.3-2599s1c1
Sequence:CCGGGATCTTTGGAGTGCCTAAGACCTCGAGGTCTTAGGCACTCCAAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002344.3-2921s1c1
Sequence:CCGGCTTGCCATGCTGGAAACCAGCCTCGAGGCTGGTTTCCAGCATGGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002344.4-2292s21c1
Sequence:CCGGAGTTTCGCCATCAGAACATTGCTCGAGCAATGTTCTGATGGCGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002344.4-3221s21c1
Sequence:CCGGACTGAGGGTCCCTCCCTATACCTCGAGGTATAGGGAGGGACCCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002344.4-2585s21c1
Sequence:CCGGTTTGGGATGGCACGAGATATCCTCGAGGATATCTCGTGCCATCCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002344.4-2504s21c1
Sequence:CCGGCACTTCATCCACAGGGATATTCTCGAGAATATCCCTGTGGATGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002344.4-2163s21c1
Sequence:CCGGTGTATGAGGGACTGGTAATTGCTCGAGCAATTACCAGTCCCTCATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002344.x-1509s1c1
Sequence:CCGGGCCAATGTTACTCTGCTCAGACTCGAGTCTGAGCAGAGTAACATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002344.x-593s1c1
Sequence:CCGGCGTCTTCGTCTCAGCAATCTTCTCGAGAAGATTGCTGAGACGAAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002344.5-603s21c1
Sequence:GTACCGGTCTTCGTCTCAGCAATCTTCTCTCGAGAGAAGATTGCTGAGACGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002344.x-1979s1c1
Sequence:CCGGCTTTGGGATGGCACGAGATATCTCGAGATATCTCGTGCCATCCCAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002344.x-2132s1c1
Sequence:CCGGGATCTTCTCACTGGGCTACATCTCGAGATGTAGCCCAGTGAGAAGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002344
LTK MISSION shRNA Lentiviral Transduction Particles
leukocyte receptor tyrosine kinase
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002344.5-1480s21c1
Sequence:GTACCGGCTCAACACTGAGCCTCCTTATCTCGAGATAAGGAGGCTCAGTGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002344.3-2599s1c1
Sequence:CCGGGATCTTTGGAGTGCCTAAGACCTCGAGGTCTTAGGCACTCCAAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002344.3-2921s1c1
Sequence:CCGGCTTGCCATGCTGGAAACCAGCCTCGAGGCTGGTTTCCAGCATGGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002344.4-2292s21c1
Sequence:CCGGAGTTTCGCCATCAGAACATTGCTCGAGCAATGTTCTGATGGCGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002344.4-3221s21c1
Sequence:CCGGACTGAGGGTCCCTCCCTATACCTCGAGGTATAGGGAGGGACCCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002344.4-2585s21c1
Sequence:CCGGTTTGGGATGGCACGAGATATCCTCGAGGATATCTCGTGCCATCCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002344.4-2504s21c1
Sequence:CCGGCACTTCATCCACAGGGATATTCTCGAGAATATCCCTGTGGATGAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002344.4-2163s21c1
Sequence:CCGGTGTATGAGGGACTGGTAATTGCTCGAGCAATTACCAGTCCCTCATACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002344.x-1509s1c1
Sequence:CCGGGCCAATGTTACTCTGCTCAGACTCGAGTCTGAGCAGAGTAACATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002344.x-593s1c1
Sequence:CCGGCGTCTTCGTCTCAGCAATCTTCTCGAGAAGATTGCTGAGACGAAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002344.5-603s21c1
Sequence:GTACCGGTCTTCGTCTCAGCAATCTTCTCTCGAGAGAAGATTGCTGAGACGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002344.x-1979s1c1
Sequence:CCGGCTTTGGGATGGCACGAGATATCTCGAGATATCTCGTGCCATCCCAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002344.x-2132s1c1
Sequence:CCGGGATCTTCTCACTGGGCTACATCTCGAGATGTAGCCCAGTGAGAAGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206941
VALIDATED
LTK MISSION shRNA Bacterial Glycerol Stock
leukocyte receptor tyrosine kinase
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206941.1-682s21c1
Sequence:CCGGCGGAGCTAGCTGTGGATAATGCTCGAGCATTATCCACAGCTAGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206941.1-2238s21c1
Sequence:CCGGGGGAAGGTCCTAGGCTACTTTCTCGAGAAAGTAGCCTAGGACCTTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206941.1-1305s21c1
Sequence:CCGGCTGACCATGCAGGACCTATTGCTCGAGCAATAGGTCCTGCATGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206941.1-1073s21c1
Sequence:CCGGTCCTCTTCCAGTGGCTATTAACTCGAGTTAATAGCCACTGGAAGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_206941.1-898s21c1
Sequence:CCGGCAGCACCCAACCCTTACTATTCTCGAGAATAGTAAGGGTTGGGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206941.1-2161s21c1
Sequence:CCGGGCTGCATGTTCAGGCATGTTTCTCGAGAAACATGCCTGAACATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206941.1-2014s21c1
Sequence:CCGGGCCTCCAACCTCAGAACATTTCTCGAGAAATGTTCTGAGGTTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206941.1-1922s1c1
Sequence:CCGGCCTAGAGCTGAGTTCTCAGAACTCGAGTTCTGAGAACTCAGCTCTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206941.1-1472s21c1
Sequence:CCGGTATCTACCAGGCCAGTTATTACTCGAGTAATAACTGGCCTGGTAGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206941.1-1478s1c1
Sequence:CCGGCCAGGCCAGTTATTATCGCAACTCGAGTTGCGATAATAACTGGCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206941.1-464s1c1
Sequence:CCGGCGGTGATACTTCTGAGTCTGACTCGAGTCAGACTCAGAAGTATCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206941.1-800s1c1
Sequence:CCGGCCTGATTCTAGTGAACCAGAACTCGAGTTCTGGTTCACTAGAATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206941.1-2073s1c1
Sequence:CCGGCAGGGTGAAGATACAGGCATTCTCGAGAATGCCTGTATCTTCACCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206941
VALIDATED
LTK MISSION shRNA shRNA Plasmid DNA
leukocyte receptor tyrosine kinase
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206941.1-682s21c1
Sequence:CCGGCGGAGCTAGCTGTGGATAATGCTCGAGCATTATCCACAGCTAGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206941.1-2238s21c1
Sequence:CCGGGGGAAGGTCCTAGGCTACTTTCTCGAGAAAGTAGCCTAGGACCTTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206941.1-1305s21c1
Sequence:CCGGCTGACCATGCAGGACCTATTGCTCGAGCAATAGGTCCTGCATGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206941.1-1073s21c1
Sequence:CCGGTCCTCTTCCAGTGGCTATTAACTCGAGTTAATAGCCACTGGAAGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_206941.1-898s21c1
Sequence:CCGGCAGCACCCAACCCTTACTATTCTCGAGAATAGTAAGGGTTGGGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206941.1-2161s21c1
Sequence:CCGGGCTGCATGTTCAGGCATGTTTCTCGAGAAACATGCCTGAACATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206941.1-2014s21c1
Sequence:CCGGGCCTCCAACCTCAGAACATTTCTCGAGAAATGTTCTGAGGTTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206941.1-1922s1c1
Sequence:CCGGCCTAGAGCTGAGTTCTCAGAACTCGAGTTCTGAGAACTCAGCTCTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206941.1-1472s21c1
Sequence:CCGGTATCTACCAGGCCAGTTATTACTCGAGTAATAACTGGCCTGGTAGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206941.1-1478s1c1
Sequence:CCGGCCAGGCCAGTTATTATCGCAACTCGAGTTGCGATAATAACTGGCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206941.1-464s1c1
Sequence:CCGGCGGTGATACTTCTGAGTCTGACTCGAGTCAGACTCAGAAGTATCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206941.1-800s1c1
Sequence:CCGGCCTGATTCTAGTGAACCAGAACTCGAGTTCTGGTTCACTAGAATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206941.1-2073s1c1
Sequence:CCGGCAGGGTGAAGATACAGGCATTCTCGAGAATGCCTGTATCTTCACCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206941
VALIDATED
LTK MISSION shRNA Lentiviral Transduction Particles
leukocyte receptor tyrosine kinase
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206941.1-682s21c1
Sequence:CCGGCGGAGCTAGCTGTGGATAATGCTCGAGCATTATCCACAGCTAGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206941.1-2238s21c1
Sequence:CCGGGGGAAGGTCCTAGGCTACTTTCTCGAGAAAGTAGCCTAGGACCTTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206941.1-1305s21c1
Sequence:CCGGCTGACCATGCAGGACCTATTGCTCGAGCAATAGGTCCTGCATGGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206941.1-1073s21c1
Sequence:CCGGTCCTCTTCCAGTGGCTATTAACTCGAGTTAATAGCCACTGGAAGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_206941.1-898s21c1
Sequence:CCGGCAGCACCCAACCCTTACTATTCTCGAGAATAGTAAGGGTTGGGTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206941.1-2161s21c1
Sequence:CCGGGCTGCATGTTCAGGCATGTTTCTCGAGAAACATGCCTGAACATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206941.1-2014s21c1
Sequence:CCGGGCCTCCAACCTCAGAACATTTCTCGAGAAATGTTCTGAGGTTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206941.1-1922s1c1
Sequence:CCGGCCTAGAGCTGAGTTCTCAGAACTCGAGTTCTGAGAACTCAGCTCTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206941.1-1472s21c1
Sequence:CCGGTATCTACCAGGCCAGTTATTACTCGAGTAATAACTGGCCTGGTAGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206941.1-1478s1c1
Sequence:CCGGCCAGGCCAGTTATTATCGCAACTCGAGTTGCGATAATAACTGGCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206941.1-464s1c1
Sequence:CCGGCGGTGATACTTCTGAGTCTGACTCGAGTCAGACTCAGAAGTATCACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206941.1-800s1c1
Sequence:CCGGCCTGATTCTAGTGAACCAGAACTCGAGTTCTGGTTCACTAGAATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206941.1-2073s1c1
Sequence:CCGGCAGGGTGAAGATACAGGCATTCTCGAGAATGCCTGTATCTTCACCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)