EMAIL THIS PAGE TO A FRIEND

LTN1

listerin E3 ubiquitin protein ligase 1

211 Gene Product Result for
Synonyms: C21orf10 C21orf98 RNF160 ZNF294
Gene ID:
Human(26046) Summary: Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]
Mouse(78913) listerin E3 ubiquitin protein ligase 1
Rat(288308) listerin E3 ubiquitin protein ligase 1
chicken(418482) listerin E3 ubiquitin protein ligase 1
cow(519526) listerin E3 ubiquitin protein ligase 1
Horse(100065649) listerin E3 ubiquitin protein ligase 1
domestic cat(101084307) listerin E3 ubiquitin protein ligase 1
domestic guinea pig(100714290) listerin E3 ubiquitin protein ligase 1
naked mole-rat(101702274) listerin E3 ubiquitin protein ligase 1
sheep(101109928) listerin E3 ubiquitin protein ligase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015565 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081068 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081068 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081068 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015565 Rosetta Predictions human pricing
NM_001024235 Rosetta Predictions rat pricing
XM_001055727 Rosetta Predictions rat pricing
XM_001066804 Rosetta Predictions rat pricing
NM_001081068 Rosetta Predictions mouse pricing
XM_128374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348119 predicted 1062
2 SASI_Hs01_00118676 predicted 4522
3 SASI_Hs02_00348120 predicted 1293
4 SASI_Hs02_00348121 predicted 4993
5 SASI_Hs02_00348122 predicted 5007
6 SASI_Hs01_00118680 predicted 546
7 SASI_Hs02_00348123 predicted 4977
8 SASI_Hs01_00118682 predicted 541
9 SASI_Hs02_00348124 predicted 1171
10 SASI_Hs02_00348125 predicted 4281
11 SASI_Hs01_00118677 predicted 2347
12 SASI_Hs01_00118678 predicted 2335
13 SASI_Hs01_00118679 predicted 2755
14 SASI_Hs01_00118681 predicted 3276
15 SASI_Hs01_00118683 predicted 2581
16 SASI_Hs01_00118684 predicted 980
17 SASI_Hs01_00118685 predicted 4870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202366 predicted 440
2 SASI_Rn02_00202367 predicted 3548
3 SASI_Rn02_00202368 predicted 5346
4 SASI_Rn02_00202369 predicted 3185
5 SASI_Rn02_00202370 predicted 1798
6 SASI_Rn02_00202371 predicted 3866
7 SASI_Rn02_00202372 predicted 4771
8 SASI_Rn02_00202373 predicted 1075
9 SASI_Rn02_00202374 predicted 2285
10 SASI_Rn02_00202375 predicted 2767
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055727 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280770 predicted 4928
2 SASI_Rn02_00280771 predicted 5491
3 SASI_Rn02_00280772 predicted 5375
4 SASI_Rn02_00280773 predicted 4908
5 SASI_Rn02_00280774 predicted 5019
6 SASI_Rn02_00280775 predicted 4940
7 SASI_Rn02_00280776 predicted 5291
8 SASI_Rn02_00280777 predicted 5386
9 SASI_Rn02_00280778 predicted 5270
10 SASI_Rn02_00280779 predicted 5046
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318754 predicted 3695
2 SASI_Rn02_00318755 predicted 276
3 SASI_Rn02_00318756 predicted 5497
4 SASI_Rn02_00318757 predicted 3328
5 SASI_Rn02_00318758 predicted 1940
6 SASI_Rn02_00318759 predicted 308
7 SASI_Rn02_00318760 predicted 4008
8 SASI_Rn02_00318761 predicted 1217
9 SASI_Rn02_00318762 predicted 2430
10 SASI_Rn02_00318763 predicted 2913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294861 predicted 3677
2 SASI_Mm02_00294862 predicted 5050
3 SASI_Mm02_00294863 predicted 4937
4 SASI_Mm02_00294864 predicted 4341
5 SASI_Mm02_00294865 predicted 3317
6 SASI_Mm02_00294866 predicted 4563
7 SASI_Mm02_00294867 predicted 4982
8 SASI_Mm02_00294868 predicted 2458
9 SASI_Mm02_00294869 predicted 305
10 SASI_Mm02_00294870 predicted 4330
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256916 predicted 3683
2 SASI_Mm01_00256917 predicted 5057
3 SASI_Mm01_00256918 predicted 4934
4 SASI_Mm01_00256919 predicted 4351
5 SASI_Mm01_00256920 predicted 3327
6 SASI_Mm01_00256921 predicted 4574
7 SASI_Mm01_00256922 predicted 2471
8 SASI_Mm01_00256923 predicted 310
9 SASI_Mm01_00256924 predicted 4333
10 SASI_Mm01_00256925 predicted 4138
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015565
VALIDATED
LTN1 MISSION shRNA Bacterial Glycerol Stock
listerin E3 ubiquitin protein ligase 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015565.1-3996s1c1
Sequence:CCGGCCTGTAAATCTAATCAGTGAACTCGAGTTCACTGATTAGATTTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015565.1-3397s1c1
Sequence:CCGGGCATTTCATCTGATGAAGTAACTCGAGTTACTTCATCAGATGAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015565.1-5328s1c1
Sequence:CCGGGCCTGCTTGTACAAATGGTTTCTCGAGAAACCATTTGTACAAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.2-4393s21c1
Sequence:CCGGGTATGATCAGGATAATCTAAACTCGAGTTTAGATTATCCTGATCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.1-1877s21c1
Sequence:CCGGAGTCTGTAAACTCGCAGATATCTCGAGATATCTGCGAGTTTACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015565.1-1450s21c1
Sequence:CCGGTGCAACATGGGCAGCTATTTACTCGAGTAAATAGCTGCCCATGTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.1-5799s21c1
Sequence:CCGGGAACTGAGAGAGCTGATTTACCTCGAGGTAAATCAGCTCTCTCAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.1-764s21c1
Sequence:CCGGCCGGGTTGTAACTTGTTCCTTCTCGAGAAGGAACAAGTTACAACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015565.1-5001s21c1
Sequence:CCGGGTAATGGCTACTTATACTATTCTCGAGAATAGTATAAGTAGCCATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.1-2454s21c1
Sequence:CCGGTACTTGATTGGAGACGTATATCTCGAGATATACGTCTCCAATCAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.1-5419s21c1
Sequence:CCGGGATCCCTGAAGTACATCAAACCTCGAGGTTTGATGTACTTCAGGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.1-2455s21c1
Sequence:CCGGACTTGATTGGAGACGTATATGCTCGAGCATATACGTCTCCAATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.2-1932s21c1
Sequence:CCGGTCTGTAAACTCGCAGATATAACTCGAGTTATATCTGCGAGTTTACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015565.2-4190s21c1
Sequence:CCGGTGTGAAACATTAACGTATATCCTCGAGGATATACGTTAATGTTTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.2-5013s21c1
Sequence:CCGGTTAATGGCATGACGGTTAAAGCTCGAGCTTTAACCGTCATGCCATTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015565
VALIDATED
LTN1 MISSION shRNA shRNA Plasmid DNA
listerin E3 ubiquitin protein ligase 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015565.1-3996s1c1
Sequence:CCGGCCTGTAAATCTAATCAGTGAACTCGAGTTCACTGATTAGATTTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015565.1-3397s1c1
Sequence:CCGGGCATTTCATCTGATGAAGTAACTCGAGTTACTTCATCAGATGAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015565.1-5328s1c1
Sequence:CCGGGCCTGCTTGTACAAATGGTTTCTCGAGAAACCATTTGTACAAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.2-4393s21c1
Sequence:CCGGGTATGATCAGGATAATCTAAACTCGAGTTTAGATTATCCTGATCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.1-1877s21c1
Sequence:CCGGAGTCTGTAAACTCGCAGATATCTCGAGATATCTGCGAGTTTACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015565.1-1450s21c1
Sequence:CCGGTGCAACATGGGCAGCTATTTACTCGAGTAAATAGCTGCCCATGTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.1-5799s21c1
Sequence:CCGGGAACTGAGAGAGCTGATTTACCTCGAGGTAAATCAGCTCTCTCAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.1-764s21c1
Sequence:CCGGCCGGGTTGTAACTTGTTCCTTCTCGAGAAGGAACAAGTTACAACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015565.1-5001s21c1
Sequence:CCGGGTAATGGCTACTTATACTATTCTCGAGAATAGTATAAGTAGCCATTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.1-2454s21c1
Sequence:CCGGTACTTGATTGGAGACGTATATCTCGAGATATACGTCTCCAATCAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.1-5419s21c1
Sequence:CCGGGATCCCTGAAGTACATCAAACCTCGAGGTTTGATGTACTTCAGGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.1-2455s21c1
Sequence:CCGGACTTGATTGGAGACGTATATGCTCGAGCATATACGTCTCCAATCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.2-1932s21c1
Sequence:CCGGTCTGTAAACTCGCAGATATAACTCGAGTTATATCTGCGAGTTTACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015565.2-4190s21c1
Sequence:CCGGTGTGAAACATTAACGTATATCCTCGAGGATATACGTTAATGTTTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.2-5013s21c1
Sequence:CCGGTTAATGGCATGACGGTTAAAGCTCGAGCTTTAACCGTCATGCCATTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015565
VALIDATED
LTN1 MISSION shRNA Lentiviral Transduction Particles
listerin E3 ubiquitin protein ligase 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015565.1-3996s1c1
Sequence:CCGGCCTGTAAATCTAATCAGTGAACTCGAGTTCACTGATTAGATTTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015565.1-3397s1c1
Sequence:CCGGGCATTTCATCTGATGAAGTAACTCGAGTTACTTCATCAGATGAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015565.1-5328s1c1
Sequence:CCGGGCCTGCTTGTACAAATGGTTTCTCGAGAAACCATTTGTACAAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.2-4393s21c1
Sequence:CCGGGTATGATCAGGATAATCTAAACTCGAGTTTAGATTATCCTGATCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.1-1877s21c1
Sequence:CCGGAGTCTGTAAACTCGCAGATATCTCGAGATATCTGCGAGTTTACAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015565.1-1450s21c1
Sequence:CCGGTGCAACATGGGCAGCTATTTACTCGAGTAAATAGCTGCCCATGTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.1-5799s21c1
Sequence:CCGGGAACTGAGAGAGCTGATTTACCTCGAGGTAAATCAGCTCTCTCAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.1-764s21c1
Sequence:CCGGCCGGGTTGTAACTTGTTCCTTCTCGAGAAGGAACAAGTTACAACCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015565.1-5001s21c1
Sequence:CCGGGTAATGGCTACTTATACTATTCTCGAGAATAGTATAAGTAGCCATTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.1-2454s21c1
Sequence:CCGGTACTTGATTGGAGACGTATATCTCGAGATATACGTCTCCAATCAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.1-5419s21c1
Sequence:CCGGGATCCCTGAAGTACATCAAACCTCGAGGTTTGATGTACTTCAGGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.1-2455s21c1
Sequence:CCGGACTTGATTGGAGACGTATATGCTCGAGCATATACGTCTCCAATCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.2-1932s21c1
Sequence:CCGGTCTGTAAACTCGCAGATATAACTCGAGTTATATCTGCGAGTTTACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015565.2-4190s21c1
Sequence:CCGGTGTGAAACATTAACGTATATCCTCGAGGATATACGTTAATGTTTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015565.2-5013s21c1
Sequence:CCGGTTAATGGCATGACGGTTAAAGCTCGAGCTTTAACCGTCATGCCATTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081068
VALIDATED
LTN1 MISSION shRNA Bacterial Glycerol Stock
listerin E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081068.1-1499s21c1
Sequence:CCGGGGACCGATGTTTGACCATTTACTCGAGTAAATGGTCAAACATCGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081068.1-4730s21c1
Sequence:CCGGGCTATTGAGGTATCAAGTAAACTCGAGTTTACTTGATACCTCAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081068.1-3687s21c1
Sequence:CCGGAGCTATTGCATGGCATATTAACTCGAGTTAATATGCCATGCAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081068.1-7468s21c1
Sequence:CCGGTCCGAAACCAAGTAGCAATTTCTCGAGAAATTGCTACTTGGTTTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081068.1-3419s21c1
Sequence:CCGGTTGATCCTTTCCCGAAGTATTCTCGAGAATACTTCGGGAAAGGATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081068
VALIDATED
LTN1 MISSION shRNA shRNA Plasmid DNA
listerin E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081068.1-1499s21c1
Sequence:CCGGGGACCGATGTTTGACCATTTACTCGAGTAAATGGTCAAACATCGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081068.1-4730s21c1
Sequence:CCGGGCTATTGAGGTATCAAGTAAACTCGAGTTTACTTGATACCTCAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081068.1-3687s21c1
Sequence:CCGGAGCTATTGCATGGCATATTAACTCGAGTTAATATGCCATGCAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081068.1-7468s21c1
Sequence:CCGGTCCGAAACCAAGTAGCAATTTCTCGAGAAATTGCTACTTGGTTTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081068.1-3419s21c1
Sequence:CCGGTTGATCCTTTCCCGAAGTATTCTCGAGAATACTTCGGGAAAGGATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081068
VALIDATED
LTN1 MISSION shRNA Lentiviral Transduction Particles
listerin E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081068.1-1499s21c1
Sequence:CCGGGGACCGATGTTTGACCATTTACTCGAGTAAATGGTCAAACATCGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081068.1-4730s21c1
Sequence:CCGGGCTATTGAGGTATCAAGTAAACTCGAGTTTACTTGATACCTCAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081068.1-3687s21c1
Sequence:CCGGAGCTATTGCATGGCATATTAACTCGAGTTAATATGCCATGCAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081068.1-7468s21c1
Sequence:CCGGTCCGAAACCAAGTAGCAATTTCTCGAGAAATTGCTACTTGGTTTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081068.1-3419s21c1
Sequence:CCGGTTGATCCTTTCCCGAAGTATTCTCGAGAATACTTCGGGAAAGGATCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)