EMAIL THIS PAGE TO A FRIEND

LTV1

LTV1 homolog (S. cerevisiae)

56 Gene Product Result for
Synonyms: C6orf93 dJ468K18.4
UniProtKB ID: Q96GA3, Q96JX8
Gene ID:
Mouse(353258) LTV1 homolog (S. cerevisiae)
Rat(361452) LTV1 homolog (S. cerevisiae)
sheep(101118880) LTV1 homolog (S. cerevisiae)
domestic guinea pig(100732739) LTV1 homolog (S. cerevisiae)
naked mole-rat(101721104) LTV1 homolog (S. cerevisiae)
Domestic Rabbit(100354191) LTV1 homolog (S. cerevisiae)
Zebrafish(436587) LTV1 homolog (S. cerevisiae)
chicken(421666) LTV1 homolog (S. cerevisiae)
dog(476232) LTV1 homolog (S. cerevisiae)
cow(507702) LTV1 homolog (S. cerevisiae)
domestic cat(101095827) LTV1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032860 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032860 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032860 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181470 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181470 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181470 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032860 Rosetta Predictions human pricing
NM_001014157 Rosetta Predictions rat pricing
NM_181470 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188581 predicted 872
2 SASI_Hs01_00188582 predicted 1151
3 SASI_Hs02_00360459 predicted 1298
4 SASI_Hs01_00188583 predicted 382
5 SASI_Hs01_00188584 predicted 806
6 SASI_Hs01_00188585 predicted 1202
7 SASI_Hs01_00188586 predicted 1341
8 SASI_Hs01_00188588 predicted 265
9 SASI_Hs01_00188589 predicted 1160
10 SASI_Hs01_00188590 predicted 586
11 SASI_Hs01_00188587 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014157 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118146 predicted 972
2 SASI_Rn01_00118148 predicted 366
3 SASI_Rn01_00118149 predicted 1055
4 SASI_Rn01_00118150 predicted 1285
5 SASI_Rn01_00118151 predicted 629
6 SASI_Rn02_00201643 predicted 913
7 SASI_Rn01_00118152 predicted 953
8 SASI_Rn01_00118153 predicted 1050
9 SASI_Rn01_00118154 predicted 1341
10 SASI_Rn01_00118155 predicted 1335
11 SASI_Rn01_00118147 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349788 predicted 832
2 SASI_Mm01_00180535 predicted 1145
3 SASI_Mm02_00349789 predicted 412
4 SASI_Mm01_00180536 predicted 1041
5 SASI_Mm01_00180537 predicted 1150
6 SASI_Mm01_00180538 predicted 1522
7 SASI_Mm02_00349790 predicted 941
8 SASI_Mm01_00180541 predicted 250
9 SASI_Mm01_00180542 predicted 1096
10 SASI_Mm01_00180543 predicted 1138
11 SASI_Mm01_00180534 predicted 1413
12 SASI_Mm01_00180539 predicted 259
13 SASI_Mm01_00180540 predicted 887
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032860
VALIDATED
LTV1 MISSION shRNA Bacterial Glycerol Stock
LTV1 homolog (S. cerevisiae)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032860.3-911s21c1
Sequence:CCGGGCAATATGATGATGATGAAATCTCGAGATTTCATCATCATCATATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032860.3-174s21c1
Sequence:CCGGCGGAGCCAACGAGATCCTTTACTCGAGTAAAGGATCTCGTTGGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032860.3-1148s21c1
Sequence:CCGGGTGGGATTGTGAATCTATTTGCTCGAGCAAATAGATTCACAATCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032860.3-817s21c1
Sequence:CCGGAGAGTCGCTTCACGGAGTATTCTCGAGAATACTCCGTGAAGCGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032860.3-418s1c1
Sequence:CCGGGCACTGGAATTAAGTTGCCTTCTCGAGAAGGCAACTTAATTCCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032860.3-343s1c1
Sequence:CCGGCAGAGCTTATTCCCTCAAGTACTCGAGTACTTGAGGGAATAAGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032860.3-1425s1c1
Sequence:CCGGGAACGAAGAGTGGAGAAGAAACTCGAGTTTCTTCTCCACTCTTCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032860.3-1391s21c1
Sequence:CCGGAGCAAGAAAGCAAGCTATAAACTCGAGTTTATAGCTTGCTTTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032860.3-1571s21c1
Sequence:CCGGGGCTCCTCATCTTTGGTTATTCTCGAGAATAACCAAAGATGAGGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032860.3-1347s21c1
Sequence:CCGGTCAACTCAGCCACGTTCTAAACTCGAGTTTAGAACGTGGCTGAGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032860.3-1222s21c1
Sequence:CCGGAGCCCAAACAAATTCGAATATCTCGAGATATTCGAATTTGTTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032860.3-1327s1c1
Sequence:CCGGGCAGTGATCTTCCTAAAGTATCTCGAGATACTTTAGGAAGATCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032860.3-1074s1c1
Sequence:CCGGCTGCCAATGAATGAGCTTGATCTCGAGATCAAGCTCATTCATTGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032860.3-570s1c1
Sequence:CCGGCCAGATAATCTGCTTGAGGATCTCGAGATCCTCAAGCAGATTATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032860.3-1575s1c1
Sequence:CCGGCCTCATCTTTGGTTATTGACTCTCGAGAGTCAATAACCAAAGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032860
VALIDATED
LTV1 MISSION shRNA shRNA Plasmid DNA
LTV1 homolog (S. cerevisiae)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032860.3-911s21c1
Sequence:CCGGGCAATATGATGATGATGAAATCTCGAGATTTCATCATCATCATATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032860.3-174s21c1
Sequence:CCGGCGGAGCCAACGAGATCCTTTACTCGAGTAAAGGATCTCGTTGGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032860.3-1148s21c1
Sequence:CCGGGTGGGATTGTGAATCTATTTGCTCGAGCAAATAGATTCACAATCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032860.3-817s21c1
Sequence:CCGGAGAGTCGCTTCACGGAGTATTCTCGAGAATACTCCGTGAAGCGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032860.3-418s1c1
Sequence:CCGGGCACTGGAATTAAGTTGCCTTCTCGAGAAGGCAACTTAATTCCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032860.3-343s1c1
Sequence:CCGGCAGAGCTTATTCCCTCAAGTACTCGAGTACTTGAGGGAATAAGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032860.3-1425s1c1
Sequence:CCGGGAACGAAGAGTGGAGAAGAAACTCGAGTTTCTTCTCCACTCTTCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032860.3-1391s21c1
Sequence:CCGGAGCAAGAAAGCAAGCTATAAACTCGAGTTTATAGCTTGCTTTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032860.3-1571s21c1
Sequence:CCGGGGCTCCTCATCTTTGGTTATTCTCGAGAATAACCAAAGATGAGGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032860.3-1347s21c1
Sequence:CCGGTCAACTCAGCCACGTTCTAAACTCGAGTTTAGAACGTGGCTGAGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032860.3-1222s21c1
Sequence:CCGGAGCCCAAACAAATTCGAATATCTCGAGATATTCGAATTTGTTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032860.3-1327s1c1
Sequence:CCGGGCAGTGATCTTCCTAAAGTATCTCGAGATACTTTAGGAAGATCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032860.3-1074s1c1
Sequence:CCGGCTGCCAATGAATGAGCTTGATCTCGAGATCAAGCTCATTCATTGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032860.3-570s1c1
Sequence:CCGGCCAGATAATCTGCTTGAGGATCTCGAGATCCTCAAGCAGATTATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032860.3-1575s1c1
Sequence:CCGGCCTCATCTTTGGTTATTGACTCTCGAGAGTCAATAACCAAAGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032860
VALIDATED
LTV1 MISSION shRNA Lentiviral Transduction Particles
LTV1 homolog (S. cerevisiae)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032860.3-911s21c1
Sequence:CCGGGCAATATGATGATGATGAAATCTCGAGATTTCATCATCATCATATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032860.3-174s21c1
Sequence:CCGGCGGAGCCAACGAGATCCTTTACTCGAGTAAAGGATCTCGTTGGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032860.3-1148s21c1
Sequence:CCGGGTGGGATTGTGAATCTATTTGCTCGAGCAAATAGATTCACAATCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032860.3-817s21c1
Sequence:CCGGAGAGTCGCTTCACGGAGTATTCTCGAGAATACTCCGTGAAGCGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032860.3-418s1c1
Sequence:CCGGGCACTGGAATTAAGTTGCCTTCTCGAGAAGGCAACTTAATTCCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032860.3-343s1c1
Sequence:CCGGCAGAGCTTATTCCCTCAAGTACTCGAGTACTTGAGGGAATAAGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032860.3-1425s1c1
Sequence:CCGGGAACGAAGAGTGGAGAAGAAACTCGAGTTTCTTCTCCACTCTTCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032860.3-1391s21c1
Sequence:CCGGAGCAAGAAAGCAAGCTATAAACTCGAGTTTATAGCTTGCTTTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032860.3-1571s21c1
Sequence:CCGGGGCTCCTCATCTTTGGTTATTCTCGAGAATAACCAAAGATGAGGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032860.3-1347s21c1
Sequence:CCGGTCAACTCAGCCACGTTCTAAACTCGAGTTTAGAACGTGGCTGAGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032860.3-1222s21c1
Sequence:CCGGAGCCCAAACAAATTCGAATATCTCGAGATATTCGAATTTGTTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032860.3-1327s1c1
Sequence:CCGGGCAGTGATCTTCCTAAAGTATCTCGAGATACTTTAGGAAGATCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032860.3-1074s1c1
Sequence:CCGGCTGCCAATGAATGAGCTTGATCTCGAGATCAAGCTCATTCATTGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032860.3-570s1c1
Sequence:CCGGCCAGATAATCTGCTTGAGGATCTCGAGATCCTCAAGCAGATTATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032860.3-1575s1c1
Sequence:CCGGCCTCATCTTTGGTTATTGACTCTCGAGAGTCAATAACCAAAGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181470
VALIDATED
LTV1 MISSION shRNA Bacterial Glycerol Stock
LTV1 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181470.2-1078s1c1
Sequence:CCGGGAAGAGACCATTACTGTAGTTCTCGAGAACTACAGTAATGGTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181470.4-1153s21c1
Sequence:CCGGGCAGTACATACTCCAATTTATCTCGAGATAAATTGGAGTATGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181470.4-1550s21c1
Sequence:CCGGCATGTCAGCAGTCTTAGTTATCTCGAGATAACTAAGACTGCTGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181470.4-1225s21c1
Sequence:CCGGTGTCGTCTAAGACCGGAATACCTCGAGGTATTCCGGTCTTAGACGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181470.4-1179s21c1
Sequence:CCGGCACCCACAGCTCATCAAATATCTCGAGATATTTGATGAGCTGTGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181470.2-1425s1c1
Sequence:CCGGGCTAGCATTTAAACTGGAGAACTCGAGTTCTCCAGTTTAAATGCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181470.2-1223s1c1
Sequence:CCGGCCGGAATACCTCTCAATGTCTCTCGAGAGACATTGAGAGGTATTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181470.4-285s21c1
Sequence:CCGGGTGTTCTTCGACGACGATTATCTCGAGATAATCGTCGTCGAAGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181470
VALIDATED
LTV1 MISSION shRNA shRNA Plasmid DNA
LTV1 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181470.2-1078s1c1
Sequence:CCGGGAAGAGACCATTACTGTAGTTCTCGAGAACTACAGTAATGGTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181470.4-1153s21c1
Sequence:CCGGGCAGTACATACTCCAATTTATCTCGAGATAAATTGGAGTATGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181470.4-1550s21c1
Sequence:CCGGCATGTCAGCAGTCTTAGTTATCTCGAGATAACTAAGACTGCTGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181470.4-1225s21c1
Sequence:CCGGTGTCGTCTAAGACCGGAATACCTCGAGGTATTCCGGTCTTAGACGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181470.4-1179s21c1
Sequence:CCGGCACCCACAGCTCATCAAATATCTCGAGATATTTGATGAGCTGTGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181470.2-1425s1c1
Sequence:CCGGGCTAGCATTTAAACTGGAGAACTCGAGTTCTCCAGTTTAAATGCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181470.2-1223s1c1
Sequence:CCGGCCGGAATACCTCTCAATGTCTCTCGAGAGACATTGAGAGGTATTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181470.4-285s21c1
Sequence:CCGGGTGTTCTTCGACGACGATTATCTCGAGATAATCGTCGTCGAAGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181470
VALIDATED
LTV1 MISSION shRNA Lentiviral Transduction Particles
LTV1 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181470.2-1078s1c1
Sequence:CCGGGAAGAGACCATTACTGTAGTTCTCGAGAACTACAGTAATGGTCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181470.4-1153s21c1
Sequence:CCGGGCAGTACATACTCCAATTTATCTCGAGATAAATTGGAGTATGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181470.4-1550s21c1
Sequence:CCGGCATGTCAGCAGTCTTAGTTATCTCGAGATAACTAAGACTGCTGACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181470.4-1225s21c1
Sequence:CCGGTGTCGTCTAAGACCGGAATACCTCGAGGTATTCCGGTCTTAGACGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181470.4-1179s21c1
Sequence:CCGGCACCCACAGCTCATCAAATATCTCGAGATATTTGATGAGCTGTGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181470.2-1425s1c1
Sequence:CCGGGCTAGCATTTAAACTGGAGAACTCGAGTTCTCCAGTTTAAATGCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181470.2-1223s1c1
Sequence:CCGGCCGGAATACCTCTCAATGTCTCTCGAGAGACATTGAGAGGTATTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181470.4-285s21c1
Sequence:CCGGGTGTTCTTCGACGACGATTATCTCGAGATAATCGTCGTCGAAGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)