EMAIL THIS PAGE TO A FRIEND

LUC7L2

LUC7-like 2 (S. cerevisiae)

158 Gene Product Result for
Synonyms: CGI-74 LUC7B2
UniProtKB ID: Q9Y383, B7Z500, Q8IUP9, Q9NVL3, Q9NVN7, Q9UQN1
Gene ID:
Human(51631) Summary: This gene encodes a protein that contains a C2H2-type zinc finger, coiled-coil region and arginine, serine-rich (RS) domain. A similar protein in mouse interacts with sodium channel modifier 1, and the encoded protein may be involved in the recognition of non-consensus splice donor sites in association with the U1 snRNP spliceosomal subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Mouse(192196) LUC7-like 2 (S. cerevisiae)
Rat(312251) LUC7-like 2 (S. cerevisiae)
domestic guinea pig(100732227) LUC7-like 2 (S. cerevisiae)
naked mole-rat(101723006) LUC7-like 2 (S. cerevisiae)
sheep(101105324) LUC7-like 2 (S. cerevisiae)
chicken(417971) LUC7-like 2 (S. cerevisiae)
cow(516355) LUC7-like 2 (S. cerevisiae)
domestic cat(101080269) LUC7-like 2 (S. cerevisiae)
dog(475529) LUC7-like 2 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138680 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138680 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138680 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016019 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016019 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016019 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016019 Rosetta Predictions human pricing
NM_001107853 Rosetta Predictions rat pricing
NM_138680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021924 predicted 1583
2 SASI_Hs02_00348701 predicted 564
3 SASI_Hs01_00021925 predicted 828
4 SASI_Hs01_00021926 predicted 639
5 SASI_Hs01_00021927 predicted 843
6 SASI_Hs02_00348702 predicted 567
7 SASI_Hs01_00021928 predicted 1590
8 SASI_Hs01_00021929 predicted 638
9 SASI_Hs02_00348703 predicted 1522
10 SASI_Hs01_00021931 predicted 1425
11 SASI_Hs01_00021930 predicted 1303
12 SASI_Hs01_00021932 predicted 1153
13 SASI_Hs01_00021933 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107853 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232925 predicted 1351
2 SASI_Rn02_00232926 predicted 604
3 SASI_Rn02_00232927 predicted 806
4 SASI_Rn02_00232928 predicted 599
5 SASI_Rn02_00232929 predicted 1518
6 SASI_Rn02_00232930 predicted 1556
7 SASI_Rn02_00232931 predicted 1384
8 SASI_Rn02_00232932 predicted 1606
9 SASI_Rn02_00232933 predicted 721
10 SASI_Rn02_00232934 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155447 predicted 1337
2 SASI_Mm01_00155448 predicted 1598
3 SASI_Mm01_00155451 predicted 545
4 SASI_Mm01_00155452 predicted 1353
5 SASI_Mm01_00155453 predicted 1540
6 SASI_Mm01_00155449 predicted 1561
7 SASI_Mm02_00339762 predicted 597
8 SASI_Mm01_00155455 predicted 1379
9 SASI_Mm01_00155456 predicted 597
10 SASI_Mm02_00339763 predicted 1538
11 SASI_Mm01_00155450 predicted 1609
12 SASI_Mm01_00155454 predicted 625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138680
VALIDATED
LUC7L2 MISSION shRNA Bacterial Glycerol Stock
LUC7-like 2 (S. cerevisiae)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138680.1-381s21c1
Sequence:CCGGTCTCGGGACGGAGATACTACTCTCGAGAGTAGTATCTCCGTCCCGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138680.1-1045s21c1
Sequence:CCGGGAAACCAGGAACGTCTGTTACCTCGAGGTAACAGACGTTCCTGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138680.1-840s21c1
Sequence:CCGGGAAGTTTATCGGAACTCTATGCTCGAGCATAGAGTTCCGATAAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138680.1-1111s21c1
Sequence:CCGGCCCGATCACATAGCAAGAATCCTCGAGGATTCTTGCTATGTGATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138680.1-971s21c1
Sequence:CCGGGCACCTGGGATTTATTGAAATCTCGAGATTTCAATAAATCCCAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138680.1-867s21c1
Sequence:CCGGTCCAGCTTCCAGCAGCAGAAACTCGAGTTTCTGCTGCTGGAAGCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138680.1-1005s21c1
Sequence:CCGGGAAGAATTAAAGAGAGTTGTACTCGAGTACAACTCTCTTTAATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138680.1-2457s1c1
Sequence:CCGGCCCAAATCTCTTGCTGCCTATCTCGAGATAGGCAGCAAGAGATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138680.1-536s1c1
Sequence:CCGGAGATTATGAAATTGCGTCCAACTCGAGTTGGACGCAATTTCATAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138680.1-537s1c1
Sequence:CCGGGATTATGAAATTGCGTCCAAACTCGAGTTTGGACGCAATTTCATAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138680.1-971s1c1
Sequence:CCGGGCACCTGGGATTTATTGAAATCTCGAGATTTCAATAAATCCCAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138680.1-1206s1c1
Sequence:CCGGCGATCCAAGTCTCGTGAGAAACTCGAGTTTCTCACGAGACTTGGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138680
VALIDATED
LUC7L2 MISSION shRNA shRNA Plasmid DNA
LUC7-like 2 (S. cerevisiae)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138680.1-381s21c1
Sequence:CCGGTCTCGGGACGGAGATACTACTCTCGAGAGTAGTATCTCCGTCCCGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138680.1-1045s21c1
Sequence:CCGGGAAACCAGGAACGTCTGTTACCTCGAGGTAACAGACGTTCCTGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138680.1-840s21c1
Sequence:CCGGGAAGTTTATCGGAACTCTATGCTCGAGCATAGAGTTCCGATAAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138680.1-1111s21c1
Sequence:CCGGCCCGATCACATAGCAAGAATCCTCGAGGATTCTTGCTATGTGATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138680.1-971s21c1
Sequence:CCGGGCACCTGGGATTTATTGAAATCTCGAGATTTCAATAAATCCCAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138680.1-867s21c1
Sequence:CCGGTCCAGCTTCCAGCAGCAGAAACTCGAGTTTCTGCTGCTGGAAGCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138680.1-1005s21c1
Sequence:CCGGGAAGAATTAAAGAGAGTTGTACTCGAGTACAACTCTCTTTAATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138680.1-2457s1c1
Sequence:CCGGCCCAAATCTCTTGCTGCCTATCTCGAGATAGGCAGCAAGAGATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138680.1-536s1c1
Sequence:CCGGAGATTATGAAATTGCGTCCAACTCGAGTTGGACGCAATTTCATAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138680.1-537s1c1
Sequence:CCGGGATTATGAAATTGCGTCCAAACTCGAGTTTGGACGCAATTTCATAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138680.1-971s1c1
Sequence:CCGGGCACCTGGGATTTATTGAAATCTCGAGATTTCAATAAATCCCAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138680.1-1206s1c1
Sequence:CCGGCGATCCAAGTCTCGTGAGAAACTCGAGTTTCTCACGAGACTTGGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138680
VALIDATED
LUC7L2 MISSION shRNA Lentiviral Transduction Particles
LUC7-like 2 (S. cerevisiae)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138680.1-381s21c1
Sequence:CCGGTCTCGGGACGGAGATACTACTCTCGAGAGTAGTATCTCCGTCCCGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138680.1-1045s21c1
Sequence:CCGGGAAACCAGGAACGTCTGTTACCTCGAGGTAACAGACGTTCCTGGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138680.1-840s21c1
Sequence:CCGGGAAGTTTATCGGAACTCTATGCTCGAGCATAGAGTTCCGATAAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138680.1-1111s21c1
Sequence:CCGGCCCGATCACATAGCAAGAATCCTCGAGGATTCTTGCTATGTGATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138680.1-971s21c1
Sequence:CCGGGCACCTGGGATTTATTGAAATCTCGAGATTTCAATAAATCCCAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138680.1-867s21c1
Sequence:CCGGTCCAGCTTCCAGCAGCAGAAACTCGAGTTTCTGCTGCTGGAAGCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138680.1-1005s21c1
Sequence:CCGGGAAGAATTAAAGAGAGTTGTACTCGAGTACAACTCTCTTTAATTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138680.1-2457s1c1
Sequence:CCGGCCCAAATCTCTTGCTGCCTATCTCGAGATAGGCAGCAAGAGATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138680.1-536s1c1
Sequence:CCGGAGATTATGAAATTGCGTCCAACTCGAGTTGGACGCAATTTCATAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138680.1-537s1c1
Sequence:CCGGGATTATGAAATTGCGTCCAAACTCGAGTTTGGACGCAATTTCATAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138680.1-971s1c1
Sequence:CCGGGCACCTGGGATTTATTGAAATCTCGAGATTTCAATAAATCCCAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138680.1-1206s1c1
Sequence:CCGGCGATCCAAGTCTCGTGAGAAACTCGAGTTTCTCACGAGACTTGGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016019
VALIDATED
LUC7L2 MISSION shRNA Bacterial Glycerol Stock
LUC7-like 2 (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016019.2-1587s21c1
Sequence:CCGGCCTACGGAGTTACGTACTATTCTCGAGAATAGTACGTAACTCCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016019.2-1479s21c1
Sequence:CCGGCGGTCCTATGAGAGTGCTAATCTCGAGATTAGCACTCTCATAGGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_016019.2-1098s21c1
Sequence:CCGGGAACGGCTGAAACGAAGAGAACTCGAGTTCTCTTCGTTTCAGCCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016019.2-879s21c1
Sequence:CCGGGCAGAGGAAGTTTATCGGAATCTCGAGATTCCGATAAACTTCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016019.2-837s21c1
Sequence:CCGGGTAATGGATGAAGTAGAGAAACTCGAGTTTCTCTACTTCATCCATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016019.x-2046s1c1
Sequence:CCGGGCTGTGGGCATTTCCTCTATTCTCGAGAATAGAGGAAATGCCCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016019.x-463s1c1
Sequence:CCGGGTAATGGATGAAGTAGAGAAACTCGAGTTTCTCTACTTCATCCATTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016019.x-724s1c1
Sequence:CCGGGAACGGCTGAAACGAAGAGAACTCGAGTTCTCTTCGTTTCAGCCGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016019.x-505s1c1
Sequence:CCGGGCAGAGGAAGTTTATCGGAATCTCGAGATTCCGATAAACTTCCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016019.x-1105s1c1
Sequence:CCGGCGGTCCTATGAGAGTGCTAATCTCGAGATTAGCACTCTCATAGGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016019.1-676s1c1
Sequence:CCGGGAAGAATTAAAGAGAGTCGTACTCGAGTACGACTCTCTTTAATTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195117    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016019.1-2060s1c1
Sequence:CCGGCTCTATTCTGTTACGTCATTACTCGAGTAATGACGTAACAGAATAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016019
VALIDATED
LUC7L2 MISSION shRNA shRNA Plasmid DNA
LUC7-like 2 (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016019.2-1587s21c1
Sequence:CCGGCCTACGGAGTTACGTACTATTCTCGAGAATAGTACGTAACTCCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016019.2-1479s21c1
Sequence:CCGGCGGTCCTATGAGAGTGCTAATCTCGAGATTAGCACTCTCATAGGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_016019.2-1098s21c1
Sequence:CCGGGAACGGCTGAAACGAAGAGAACTCGAGTTCTCTTCGTTTCAGCCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016019.2-879s21c1
Sequence:CCGGGCAGAGGAAGTTTATCGGAATCTCGAGATTCCGATAAACTTCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016019.2-837s21c1
Sequence:CCGGGTAATGGATGAAGTAGAGAAACTCGAGTTTCTCTACTTCATCCATTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016019.x-2046s1c1
Sequence:CCGGGCTGTGGGCATTTCCTCTATTCTCGAGAATAGAGGAAATGCCCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016019.x-463s1c1
Sequence:CCGGGTAATGGATGAAGTAGAGAAACTCGAGTTTCTCTACTTCATCCATTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016019.x-724s1c1
Sequence:CCGGGAACGGCTGAAACGAAGAGAACTCGAGTTCTCTTCGTTTCAGCCGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016019.x-505s1c1
Sequence:CCGGGCAGAGGAAGTTTATCGGAATCTCGAGATTCCGATAAACTTCCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016019.x-1105s1c1
Sequence:CCGGCGGTCCTATGAGAGTGCTAATCTCGAGATTAGCACTCTCATAGGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016019.1-676s1c1
Sequence:CCGGGAAGAATTAAAGAGAGTCGTACTCGAGTACGACTCTCTTTAATTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195117    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016019.1-2060s1c1
Sequence:CCGGCTCTATTCTGTTACGTCATTACTCGAGTAATGACGTAACAGAATAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016019
VALIDATED
LUC7L2 MISSION shRNA Lentiviral Transduction Particles
LUC7-like 2 (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016019.2-1587s21c1
Sequence:CCGGCCTACGGAGTTACGTACTATTCTCGAGAATAGTACGTAACTCCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016019.2-1479s21c1
Sequence:CCGGCGGTCCTATGAGAGTGCTAATCTCGAGATTAGCACTCTCATAGGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_016019.2-1098s21c1
Sequence:CCGGGAACGGCTGAAACGAAGAGAACTCGAGTTCTCTTCGTTTCAGCCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016019.2-879s21c1
Sequence:CCGGGCAGAGGAAGTTTATCGGAATCTCGAGATTCCGATAAACTTCCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016019.2-837s21c1
Sequence:CCGGGTAATGGATGAAGTAGAGAAACTCGAGTTTCTCTACTTCATCCATTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016019.x-2046s1c1
Sequence:CCGGGCTGTGGGCATTTCCTCTATTCTCGAGAATAGAGGAAATGCCCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016019.x-463s1c1
Sequence:CCGGGTAATGGATGAAGTAGAGAAACTCGAGTTTCTCTACTTCATCCATTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016019.x-724s1c1
Sequence:CCGGGAACGGCTGAAACGAAGAGAACTCGAGTTCTCTTCGTTTCAGCCGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016019.x-505s1c1
Sequence:CCGGGCAGAGGAAGTTTATCGGAATCTCGAGATTCCGATAAACTTCCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016019.x-1105s1c1
Sequence:CCGGCGGTCCTATGAGAGTGCTAATCTCGAGATTAGCACTCTCATAGGACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016019.1-676s1c1
Sequence:CCGGGAAGAATTAAAGAGAGTCGTACTCGAGTACGACTCTCTTTAATTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195117    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016019.1-2060s1c1
Sequence:CCGGCTCTATTCTGTTACGTCATTACTCGAGTAATGACGTAACAGAATAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)