EMAIL THIS PAGE TO A FRIEND

LUC7L3

LUC7-like 3 (S. cerevisiae)

186 Gene Product Result for
Synonyms: CRA CREAP-1 CROP LUC7A OA48-18 hLuc7A
UniProtKB ID: O95232, B3KN54, D3DTY1, Q6PHR9, Q9NUY0, Q9P2S7
Gene ID:
Human(51747) Summary: This gene encodes a protein with an N-terminal half that contains cysteine/histidine motifs and leucine zipper-like repeats, and the C-terminal half is rich in arginine and glutamate residues (RE domain) and arginine and serine residues (RS domain). This protein localizes with a speckled pattern in the nucleus, and could be involved in the formation of splicesome via the RE and RS domains. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2009]
Mouse(67684) LUC7-like 3 (S. cerevisiae)
Rat(360602) LUC7-like 3 (S. cerevisiae)
Zebrafish(724014) LUC7-like 3 (S. cerevisiae)
cow(539955) LUC7-like 3 (S. cerevisiae)
domestic cat(101089475) LUC7-like 3 (S. cerevisiae)
dog(100683290) LUC7-like 3 (S. cerevisiae)
chicken(428677) LUC7-like 3 (S. cerevisiae)
sheep(101104585) LUC7-like 3 (S. cerevisiae)
naked mole-rat(101719667) LUC7-like 3 (S. cerevisiae)
domestic guinea pig(100727571) LUC7-like 3 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006107 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026313 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026313 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026313 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU049341 MISSION® esiRNA esiRNA targeting mouse 3300001P08Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006107 Rosetta Predictions human pricing
NM_016424 Rosetta Predictions human pricing
NM_001108291 Rosetta Predictions rat pricing
NM_026313 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055142 predicted 369
2 SASI_Hs01_00055143 predicted 207
3 SASI_Hs02_00340894 predicted 1212
4 SASI_Hs01_00055145 predicted 618
5 SASI_Hs01_00055146 predicted 631
6 SASI_Hs02_00340895 predicted 341
7 SASI_Hs01_00055147 predicted 421
8 SASI_Hs01_00055148 predicted 590
9 SASI_Hs01_00055149 predicted 618
10 SASI_Hs01_00055150 predicted 380
11 SASI_Hs01_00055144 predicted 254
12 SASI_Hs01_00055151 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104233 predicted 373
2 SASI_Hs01_00104234 predicted 204
3 SASI_Hs02_00349449 predicted 1211
4 SASI_Hs01_00104236 predicted 619
5 SASI_Hs01_00104237 predicted 637
6 SASI_Hs02_00349450 predicted 344
7 SASI_Hs01_00104238 predicted 417
8 SASI_Hs01_00104239 predicted 590
9 SASI_Hs01_00104240 predicted 619
10 SASI_Hs01_00104241 predicted 378
11 SASI_Hs01_00104235 predicted 249
12 SASI_Hs01_00104242 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108291 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237209 predicted 668
2 SASI_Rn02_00237210 predicted 574
3 SASI_Rn02_00237211 predicted 373
4 SASI_Rn02_00237212 predicted 381
5 SASI_Rn02_00237213 predicted 1447
6 SASI_Rn02_00237214 predicted 1449
7 SASI_Rn02_00237215 predicted 1407
8 SASI_Rn02_00237216 predicted 1361
9 SASI_Rn02_00237217 predicted 611
10 SASI_Rn02_00237218 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026313 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062465 predicted 531
2 SASI_Mm01_00062466 predicted 326
3 SASI_Mm01_00062467 predicted 625
4 SASI_Mm01_00062468 predicted 634
5 SASI_Mm02_00330015 predicted 1378
6 SASI_Mm01_00062469 predicted 1319
7 SASI_Mm01_00062470 predicted 1193
8 SASI_Mm01_00062471 predicted 336
9 SASI_Mm01_00062472 predicted 1345
10 SASI_Mm01_00062474 predicted 272
11 SASI_Mm01_00062473 predicted 219
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006107
VALIDATED
LUC7L3 MISSION shRNA Bacterial Glycerol Stock
LUC7-like 3 (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006107.2-1489s1c1
Sequence:CCGGGCATAAAGTGAAGATCGACATCTCGAGATGTCGATCTTCACTTTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006107.2-1182s1c1
Sequence:CCGGCCGGGATCGAAAGTCATATAACTCGAGTTATATGACTTTCGATCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006107.2-247s1c1
Sequence:CCGGCCTGCGGAATTGTTCACAAATCTCGAGATTTGTGAACAATTCCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006107.2-1019s1c1
Sequence:CCGGGCCGAACATCAGACAGAAGATCTCGAGATCTTCTGTCTGATGTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006107.2-735s1c1
Sequence:CCGGCCGGGTAGATGACCATTTGATCTCGAGATCAAATGGTCATCTACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006107.2-1489s21c1
Sequence:CCGGGCATAAAGTGAAGATCGACATCTCGAGATGTCGATCTTCACTTTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_006107.2-1019s21c1
Sequence:CCGGGCCGAACATCAGACAGAAGATCTCGAGATCTTCTGTCTGATGTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006107.2-1182s21c1
Sequence:CCGGCCGGGATCGAAAGTCATATAACTCGAGTTATATGACTTTCGATCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006107.2-634s21c1
Sequence:CCGGAGGTCCACAACGTCGACAATTCTCGAGAATTGTCGACGTTGTGGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006107.2-840s21c1
Sequence:CCGGTGATCGTGATGAGCGTCTAAACTCGAGTTTAGACGCTCATCACGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006107
VALIDATED
LUC7L3 MISSION shRNA shRNA Plasmid DNA
LUC7-like 3 (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006107.2-1489s1c1
Sequence:CCGGGCATAAAGTGAAGATCGACATCTCGAGATGTCGATCTTCACTTTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006107.2-1182s1c1
Sequence:CCGGCCGGGATCGAAAGTCATATAACTCGAGTTATATGACTTTCGATCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006107.2-247s1c1
Sequence:CCGGCCTGCGGAATTGTTCACAAATCTCGAGATTTGTGAACAATTCCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006107.2-1019s1c1
Sequence:CCGGGCCGAACATCAGACAGAAGATCTCGAGATCTTCTGTCTGATGTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006107.2-735s1c1
Sequence:CCGGCCGGGTAGATGACCATTTGATCTCGAGATCAAATGGTCATCTACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006107.2-1489s21c1
Sequence:CCGGGCATAAAGTGAAGATCGACATCTCGAGATGTCGATCTTCACTTTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_006107.2-1019s21c1
Sequence:CCGGGCCGAACATCAGACAGAAGATCTCGAGATCTTCTGTCTGATGTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006107.2-1182s21c1
Sequence:CCGGCCGGGATCGAAAGTCATATAACTCGAGTTATATGACTTTCGATCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006107.2-634s21c1
Sequence:CCGGAGGTCCACAACGTCGACAATTCTCGAGAATTGTCGACGTTGTGGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006107.2-840s21c1
Sequence:CCGGTGATCGTGATGAGCGTCTAAACTCGAGTTTAGACGCTCATCACGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006107
VALIDATED
LUC7L3 MISSION shRNA Lentiviral Transduction Particles
LUC7-like 3 (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006107.2-1489s1c1
Sequence:CCGGGCATAAAGTGAAGATCGACATCTCGAGATGTCGATCTTCACTTTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006107.2-1182s1c1
Sequence:CCGGCCGGGATCGAAAGTCATATAACTCGAGTTATATGACTTTCGATCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006107.2-247s1c1
Sequence:CCGGCCTGCGGAATTGTTCACAAATCTCGAGATTTGTGAACAATTCCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006107.2-1019s1c1
Sequence:CCGGGCCGAACATCAGACAGAAGATCTCGAGATCTTCTGTCTGATGTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006107.2-735s1c1
Sequence:CCGGCCGGGTAGATGACCATTTGATCTCGAGATCAAATGGTCATCTACCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006107.2-1489s21c1
Sequence:CCGGGCATAAAGTGAAGATCGACATCTCGAGATGTCGATCTTCACTTTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_006107.2-1019s21c1
Sequence:CCGGGCCGAACATCAGACAGAAGATCTCGAGATCTTCTGTCTGATGTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006107.2-1182s21c1
Sequence:CCGGCCGGGATCGAAAGTCATATAACTCGAGTTATATGACTTTCGATCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006107.2-634s21c1
Sequence:CCGGAGGTCCACAACGTCGACAATTCTCGAGAATTGTCGACGTTGTGGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006107.2-840s21c1
Sequence:CCGGTGATCGTGATGAGCGTCTAAACTCGAGTTTAGACGCTCATCACGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026313
VALIDATED
LUC7L3 MISSION shRNA Bacterial Glycerol Stock
LUC7-like 3 (S. cerevisiae)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026313.1-2370s1c1
Sequence:CCGGGCCATAGTATAGAGGAATAATCTCGAGATTATTCCTCTATACTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026313.1-1439s1c1
Sequence:CCGGGCCGAGTAAGAAGACATACAACTCGAGTTGTATGTCTTCTTACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026313.1-415s1c1
Sequence:CCGGCGCAGAATTAGACGAGGTCATCTCGAGATGACCTCGTCTAATTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026313.1-333s1c1
Sequence:CCGGTGAGAAGAGTTCTCGCTTTATCTCGAGATAAAGCGAGAACTCTTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026313.1-1187s1c1
Sequence:CCGGGCCGAGATCGAAAGTCATATACTCGAGTATATGACTTTCGATCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026313.1-253s21c1
Sequence:CCGGCCTGCGGAATTGTTCACAAATCTCGAGATTTGTGAACAATTCCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026313.1-1375s21c1
Sequence:CCGGGGGACCAGTGAAGACATTAAACTCGAGTTTAATGTCTTCACTGGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026313.1-1916s21c1
Sequence:CCGGGTGTAGGGTTTATGAATTATTCTCGAGAATAATTCATAAACCCTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026313.1-333s21c1
Sequence:CCGGTGAGAAGAGTTCTCGCTTTATCTCGAGATAAAGCGAGAACTCTTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026313.1-1187s21c1
Sequence:CCGGGCCGAGATCGAAAGTCATATACTCGAGTATATGACTTTCGATCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026313.1-2052s21c1
Sequence:CCGGCTCTACCCACATCCGTGTTTGCTCGAGCAAACACGGATGTGGGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026313
VALIDATED
LUC7L3 MISSION shRNA shRNA Plasmid DNA
LUC7-like 3 (S. cerevisiae)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026313.1-2370s1c1
Sequence:CCGGGCCATAGTATAGAGGAATAATCTCGAGATTATTCCTCTATACTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026313.1-1439s1c1
Sequence:CCGGGCCGAGTAAGAAGACATACAACTCGAGTTGTATGTCTTCTTACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026313.1-415s1c1
Sequence:CCGGCGCAGAATTAGACGAGGTCATCTCGAGATGACCTCGTCTAATTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026313.1-333s1c1
Sequence:CCGGTGAGAAGAGTTCTCGCTTTATCTCGAGATAAAGCGAGAACTCTTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026313.1-1187s1c1
Sequence:CCGGGCCGAGATCGAAAGTCATATACTCGAGTATATGACTTTCGATCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026313.1-253s21c1
Sequence:CCGGCCTGCGGAATTGTTCACAAATCTCGAGATTTGTGAACAATTCCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026313.1-1375s21c1
Sequence:CCGGGGGACCAGTGAAGACATTAAACTCGAGTTTAATGTCTTCACTGGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026313.1-1916s21c1
Sequence:CCGGGTGTAGGGTTTATGAATTATTCTCGAGAATAATTCATAAACCCTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026313.1-333s21c1
Sequence:CCGGTGAGAAGAGTTCTCGCTTTATCTCGAGATAAAGCGAGAACTCTTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026313.1-1187s21c1
Sequence:CCGGGCCGAGATCGAAAGTCATATACTCGAGTATATGACTTTCGATCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026313.1-2052s21c1
Sequence:CCGGCTCTACCCACATCCGTGTTTGCTCGAGCAAACACGGATGTGGGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026313
VALIDATED
LUC7L3 MISSION shRNA Lentiviral Transduction Particles
LUC7-like 3 (S. cerevisiae)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026313.1-2370s1c1
Sequence:CCGGGCCATAGTATAGAGGAATAATCTCGAGATTATTCCTCTATACTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026313.1-1439s1c1
Sequence:CCGGGCCGAGTAAGAAGACATACAACTCGAGTTGTATGTCTTCTTACTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026313.1-415s1c1
Sequence:CCGGCGCAGAATTAGACGAGGTCATCTCGAGATGACCTCGTCTAATTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026313.1-333s1c1
Sequence:CCGGTGAGAAGAGTTCTCGCTTTATCTCGAGATAAAGCGAGAACTCTTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026313.1-1187s1c1
Sequence:CCGGGCCGAGATCGAAAGTCATATACTCGAGTATATGACTTTCGATCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026313.1-253s21c1
Sequence:CCGGCCTGCGGAATTGTTCACAAATCTCGAGATTTGTGAACAATTCCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026313.1-1375s21c1
Sequence:CCGGGGGACCAGTGAAGACATTAAACTCGAGTTTAATGTCTTCACTGGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026313.1-1916s21c1
Sequence:CCGGGTGTAGGGTTTATGAATTATTCTCGAGAATAATTCATAAACCCTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026313.1-333s21c1
Sequence:CCGGTGAGAAGAGTTCTCGCTTTATCTCGAGATAAAGCGAGAACTCTTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026313.1-1187s21c1
Sequence:CCGGGCCGAGATCGAAAGTCATATACTCGAGTATATGACTTTCGATCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026313.1-2052s21c1
Sequence:CCGGCTCTACCCACATCCGTGTTTGCTCGAGCAAACACGGATGTGGGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)