EMAIL THIS PAGE TO A FRIEND

LUM

lumican

76 Gene Product Result for
Synonyms: LDC SLRR2D
UniProtKB ID: P51884, B2R6R5, Q96QM7
Gene ID:
Human(4060) Summary: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. In these bifunctional molecules, the protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacings. Lumican is the major keratan sulfate proteoglycan of the cornea but is also distributed in interstitial collagenous matrices throughout the body. Lumican may regulate collagen fibril organization and circumferential growth, corneal transparency, and epithelial cell migration and tissue repair. [provided by RefSeq, Jul 2008]
Mouse(17022) lumican
Rat(81682) lumican
chicken(417891) lumican
cow(280847) lumican
dog(482599) lumican
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1571 Human Lumican ELISA human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002345 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008524 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008524 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008524 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015101 MISSION® esiRNA esiRNA targeting human LUM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002345 Rosetta Predictions human pricing
NM_031050 Rosetta Predictions rat pricing
NM_008524 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221302 predicted 1247
2 SASI_Hs01_00221303 predicted 1041
3 SASI_Hs01_00221304 predicted 534
4 SASI_Hs01_00221305 predicted 1184
5 SASI_Hs01_00221306 predicted 1243
6 SASI_Hs01_00221307 predicted 509
7 SASI_Hs01_00221308 predicted 387
8 SASI_Hs01_00221311 predicted 1277
9 SASI_Hs02_00333669 predicted 498
10 SASI_Hs02_00333670 predicted 436
11 SASI_Hs01_00221309 predicted 467
12 SASI_Hs01_00221310 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031050 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094907 predicted 290
2 SASI_Rn01_00094908 predicted 1138
3 SASI_Rn01_00094909 predicted 961
4 SASI_Rn02_00264275 predicted 1143
5 SASI_Rn01_00094910 predicted 911
6 SASI_Rn01_00094911 predicted 732
7 SASI_Rn02_00264276 predicted 478
8 SASI_Rn01_00094912 predicted 1094
9 SASI_Rn01_00094914 predicted 780
10 SASI_Rn01_00094916 predicted 587
11 SASI_Rn01_00094913 predicted 951
12 SASI_Rn01_00094915 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008524 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179585 predicted 627
2 SASI_Mm02_00314107 predicted 1272
3 SASI_Mm01_00179588 predicted 554
4 SASI_Mm01_00179591 predicted 1089
5 SASI_Mm01_00179592 predicted 964
6 SASI_Mm02_00314108 predicted 510
7 SASI_Mm02_00314109 predicted 1106
8 SASI_Mm02_00314110 predicted 463
9 SASI_Mm01_00179593 predicted 1376
10 SASI_Mm01_00179594 predicted 1205
11 SASI_Mm01_00179586 predicted 956
12 SASI_Mm01_00179587 predicted 1105
13 SASI_Mm01_00179589 predicted 691
14 SASI_Mm01_00179590 predicted 874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002345
VALIDATED
LUM MISSION shRNA Bacterial Glycerol Stock
lumican
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002345.3-504s21c1
Sequence:CCGGCCAGAATGTAACTGCCCTGAACTCGAGTTCAGGGCAGTTACATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002345.3-1077s21c1
Sequence:CCGGGCATTGCAGTATCTGCGTTTACTCGAGTAAACGCAGATACTGCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002345.3-1383s21c1
Sequence:CCGGGCTAACGAAGTCACTCTTAATCTCGAGATTAAGAGTGACTTCGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002345.3-947s21c1
Sequence:CCGGCGAATACCTTGACTTGAGCTTCTCGAGAAGCTCAAGTCAAGGTATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002345.2-256s1c1
Sequence:CCGGCCAGAATGTAACTGCCCTGAACTCGAGTTCAGGGCAGTTACATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002345.2-1038s1c1
Sequence:CCGGGCCATTATCCTACTCCAAGATCTCGAGATCTTGGAGTAGGATAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002345.2-829s1c1
Sequence:CCGGGCATTGCAGTATCTGCGTTTACTCGAGTAAACGCAGATACTGCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002345.2-699s1c1
Sequence:CCGGCGAATACCTTGACTTGAGCTTCTCGAGAAGCTCAAGTCAAGGTATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_002345.2-1046s1c1
Sequence:CCGGCCTACTCCAAGATCAAGCATTCTCGAGAATGCTTGATCTTGGAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002345.2-567s1c1
Sequence:CCGGGCAGCTTACTCATAACAAGATCTCGAGATCTTGTTATGAGTAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002345.2-394s1c1
Sequence:CCGGGCCTTTGAGAATGTAACTGATCTCGAGATCAGTTACATTCTCAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002345.2-498s1c1
Sequence:CCGGGAAGCTGCATATAAACCACAACTCGAGTTGTGGTTTATATGCAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002345.2-1135s1c1
Sequence:CCGGGCTAACGAAGTCACTCTTAATCTCGAGATTAAGAGTGACTTCGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002345
VALIDATED
LUM MISSION shRNA shRNA Plasmid DNA
lumican
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002345.3-504s21c1
Sequence:CCGGCCAGAATGTAACTGCCCTGAACTCGAGTTCAGGGCAGTTACATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002345.3-1077s21c1
Sequence:CCGGGCATTGCAGTATCTGCGTTTACTCGAGTAAACGCAGATACTGCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002345.3-1383s21c1
Sequence:CCGGGCTAACGAAGTCACTCTTAATCTCGAGATTAAGAGTGACTTCGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002345.3-947s21c1
Sequence:CCGGCGAATACCTTGACTTGAGCTTCTCGAGAAGCTCAAGTCAAGGTATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002345.2-256s1c1
Sequence:CCGGCCAGAATGTAACTGCCCTGAACTCGAGTTCAGGGCAGTTACATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002345.2-1038s1c1
Sequence:CCGGGCCATTATCCTACTCCAAGATCTCGAGATCTTGGAGTAGGATAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002345.2-829s1c1
Sequence:CCGGGCATTGCAGTATCTGCGTTTACTCGAGTAAACGCAGATACTGCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002345.2-699s1c1
Sequence:CCGGCGAATACCTTGACTTGAGCTTCTCGAGAAGCTCAAGTCAAGGTATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_002345.2-1046s1c1
Sequence:CCGGCCTACTCCAAGATCAAGCATTCTCGAGAATGCTTGATCTTGGAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002345.2-567s1c1
Sequence:CCGGGCAGCTTACTCATAACAAGATCTCGAGATCTTGTTATGAGTAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002345.2-394s1c1
Sequence:CCGGGCCTTTGAGAATGTAACTGATCTCGAGATCAGTTACATTCTCAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002345.2-498s1c1
Sequence:CCGGGAAGCTGCATATAAACCACAACTCGAGTTGTGGTTTATATGCAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002345.2-1135s1c1
Sequence:CCGGGCTAACGAAGTCACTCTTAATCTCGAGATTAAGAGTGACTTCGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002345
VALIDATED
LUM MISSION shRNA Lentiviral Transduction Particles
lumican
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002345.3-504s21c1
Sequence:CCGGCCAGAATGTAACTGCCCTGAACTCGAGTTCAGGGCAGTTACATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002345.3-1077s21c1
Sequence:CCGGGCATTGCAGTATCTGCGTTTACTCGAGTAAACGCAGATACTGCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002345.3-1383s21c1
Sequence:CCGGGCTAACGAAGTCACTCTTAATCTCGAGATTAAGAGTGACTTCGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002345.3-947s21c1
Sequence:CCGGCGAATACCTTGACTTGAGCTTCTCGAGAAGCTCAAGTCAAGGTATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002345.2-256s1c1
Sequence:CCGGCCAGAATGTAACTGCCCTGAACTCGAGTTCAGGGCAGTTACATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002345.2-1038s1c1
Sequence:CCGGGCCATTATCCTACTCCAAGATCTCGAGATCTTGGAGTAGGATAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002345.2-829s1c1
Sequence:CCGGGCATTGCAGTATCTGCGTTTACTCGAGTAAACGCAGATACTGCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002345.2-699s1c1
Sequence:CCGGCGAATACCTTGACTTGAGCTTCTCGAGAAGCTCAAGTCAAGGTATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_002345.2-1046s1c1
Sequence:CCGGCCTACTCCAAGATCAAGCATTCTCGAGAATGCTTGATCTTGGAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002345.2-567s1c1
Sequence:CCGGGCAGCTTACTCATAACAAGATCTCGAGATCTTGTTATGAGTAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002345.2-394s1c1
Sequence:CCGGGCCTTTGAGAATGTAACTGATCTCGAGATCAGTTACATTCTCAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002345.2-498s1c1
Sequence:CCGGGAAGCTGCATATAAACCACAACTCGAGTTGTGGTTTATATGCAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002345.2-1135s1c1
Sequence:CCGGGCTAACGAAGTCACTCTTAATCTCGAGATTAAGAGTGACTTCGTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008524
VALIDATED
LUM MISSION shRNA Bacterial Glycerol Stock
lumican
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008524.1-1535s1c1
Sequence:CCGGGCAGACATTTATACTCTGCATCTCGAGATGCAGAGTATAAATGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008524.1-826s1c1
Sequence:CCGGCCTGGAAACTCGTTTAATATACTCGAGTATATTAAACGAGTTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008524.1-558s1c1
Sequence:CCGGGCTGGTCAACTTGACCTTCATCTCGAGATGAAGGTCAAGTTGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008524.1-559s1c1
Sequence:CCGGCTGGTCAACTTGACCTTCATTCTCGAGAATGAAGGTCAAGTTGACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008524.1-150s1c1
Sequence:CCGGCGATTATGACATCCCTCTCTTCTCGAGAAGAGAGGGATGTCATAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008524
VALIDATED
LUM MISSION shRNA shRNA Plasmid DNA
lumican
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008524.1-1535s1c1
Sequence:CCGGGCAGACATTTATACTCTGCATCTCGAGATGCAGAGTATAAATGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008524.1-826s1c1
Sequence:CCGGCCTGGAAACTCGTTTAATATACTCGAGTATATTAAACGAGTTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008524.1-558s1c1
Sequence:CCGGGCTGGTCAACTTGACCTTCATCTCGAGATGAAGGTCAAGTTGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008524.1-559s1c1
Sequence:CCGGCTGGTCAACTTGACCTTCATTCTCGAGAATGAAGGTCAAGTTGACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008524.1-150s1c1
Sequence:CCGGCGATTATGACATCCCTCTCTTCTCGAGAAGAGAGGGATGTCATAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008524
VALIDATED
LUM MISSION shRNA Lentiviral Transduction Particles
lumican
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008524.1-1535s1c1
Sequence:CCGGGCAGACATTTATACTCTGCATCTCGAGATGCAGAGTATAAATGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008524.1-826s1c1
Sequence:CCGGCCTGGAAACTCGTTTAATATACTCGAGTATATTAAACGAGTTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008524.1-558s1c1
Sequence:CCGGGCTGGTCAACTTGACCTTCATCTCGAGATGAAGGTCAAGTTGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008524.1-559s1c1
Sequence:CCGGCTGGTCAACTTGACCTTCATTCTCGAGAATGAAGGTCAAGTTGACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008524.1-150s1c1
Sequence:CCGGCGATTATGACATCCCTCTCTTCTCGAGAAGAGAGGGATGTCATAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)