EMAIL THIS PAGE TO A FRIEND

LURAP1

leucine rich adaptor protein 1

71 Gene Product Result for
Synonyms: C1orf190 LRAP35a LRP35A
UniProtKB ID: Q96LR2
Gene ID:
Mouse(68075) leucine rich adaptor protein 1
Rat(500527) leucine rich adaptor protein 1
domestic cat(101094279) leucine rich adaptor protein 1
cow(785028) leucine rich adaptor protein 1
dog(475369) leucine rich adaptor protein 1
sheep(101102347) leucine rich adaptor protein 1
naked mole-rat(101730186) leucine rich adaptor protein 1
domestic guinea pig(100733281) leucine rich adaptor protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013615 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026547 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026547 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026547 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111541 MISSION® esiRNA esiRNA human C1orf190 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013615 Rosetta Predictions human pricing
NM_001109263 Rosetta Predictions rat pricing
XM_204182 Rosetta Predictions mouse pricing
XM_905074 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022432 predicted 506
2 SASI_Hs01_00022433 predicted 589
3 SASI_Hs01_00022435 predicted 664
4 SASI_Hs01_00022436 predicted 304
5 SASI_Hs01_00022434 predicted 258
6 SASI_Hs01_00022437 predicted 405
7 SASI_Hs01_00022438 predicted 884
8 SASI_Hs01_00022439 predicted 974
9 SASI_Hs02_00306380 predicted 800
10 SASI_Hs01_00022440 predicted 752
11 SASI_Hs01_00022441 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109263 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246694 predicted 836
2 SASI_Rn02_00246695 predicted 678
3 SASI_Rn02_00246696 predicted 1009
4 SASI_Rn02_00246697 predicted 520
5 SASI_Rn02_00246698 predicted 1162
6 SASI_Rn02_00246699 predicted 339
7 SASI_Rn02_00246700 predicted 913
8 SASI_Rn02_00246701 predicted 799
9 SASI_Rn02_00246702 predicted 597
10 SASI_Rn02_00246703 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_204182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425530 predicted 1021
2 SASI_Mm02_00425531 predicted 534
3 SASI_Mm01_00262515 predicted 1126
4 SASI_Mm02_00425532 predicted 354
5 SASI_Mm02_00425533 predicted 666
6 SASI_Mm02_00425534 predicted 954
7 SASI_Mm02_00425535 predicted 988
8 SASI_Mm02_00425536 predicted 1016
9 SASI_Mm02_00425537 predicted 998
10 SASI_Mm02_00425538 predicted 358
11 SASI_Mm01_00262513 predicted 1066
12 SASI_Mm01_00262514 predicted 1065
13 SASI_Mm01_00262516 predicted 1191
14 SASI_Mm01_00262517 predicted 1131
15 SASI_Mm01_00262518 predicted 1216
16 SASI_Mm01_00262519 predicted 1132
17 SASI_Mm01_00262520 predicted 1120
18 SASI_Mm01_00262521 predicted 1219
19 SASI_Mm01_00262522 predicted 1219
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431438 predicted 1021
2 SASI_Mm02_00431439 predicted 533
3 SASI_Mm02_00431440 predicted 1130
4 SASI_Mm02_00431441 predicted 362
5 SASI_Mm02_00431442 predicted 674
6 SASI_Mm02_00431443 predicted 948
7 SASI_Mm02_00431444 predicted 993
8 SASI_Mm02_00431445 predicted 1019
9 SASI_Mm02_00431446 predicted 1004
10 SASI_Mm02_00431447 predicted 362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013615
LURAP1 MISSION shRNA Bacterial Glycerol Stock
leucine rich adaptor protein 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013615.1-789s1c1
Sequence:CCGGCCAGGATGATGTGACCTTCTTCTCGAGAAGAAGGTCACATCATCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013615.1-1118s1c1
Sequence:CCGGGCTCAAGCGATCCTCCTATTTCTCGAGAAATAGGAGGATCGCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013615.1-513s1c1
Sequence:CCGGCAGTGTCTCTATTGGCAGCTTCTCGAGAAGCTGCCAATAGAGACACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013615.1-1943s1c1
Sequence:CCGGGCCTCCATTTATTTCTCTCAACTCGAGTTGAGAGAAATAAATGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163796    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013615.1-1700s1c1
Sequence:CCGGGCTGCTAAGTGAGATCACATTCTCGAGAATGTGATCTCACTTAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013615.1-1770s1c1
Sequence:CCGGCCTGGCAGGAAAGTTTCTCATCTCGAGATGAGAAACTTTCCTGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013615
LURAP1 MISSION shRNA shRNA Plasmid DNA
leucine rich adaptor protein 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013615.1-789s1c1
Sequence:CCGGCCAGGATGATGTGACCTTCTTCTCGAGAAGAAGGTCACATCATCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013615.1-1118s1c1
Sequence:CCGGGCTCAAGCGATCCTCCTATTTCTCGAGAAATAGGAGGATCGCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013615.1-513s1c1
Sequence:CCGGCAGTGTCTCTATTGGCAGCTTCTCGAGAAGCTGCCAATAGAGACACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013615.1-1943s1c1
Sequence:CCGGGCCTCCATTTATTTCTCTCAACTCGAGTTGAGAGAAATAAATGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163796    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013615.1-1700s1c1
Sequence:CCGGGCTGCTAAGTGAGATCACATTCTCGAGAATGTGATCTCACTTAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013615.1-1770s1c1
Sequence:CCGGCCTGGCAGGAAAGTTTCTCATCTCGAGATGAGAAACTTTCCTGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013615
LURAP1 MISSION shRNA Lentiviral Transduction Particles
leucine rich adaptor protein 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013615.1-789s1c1
Sequence:CCGGCCAGGATGATGTGACCTTCTTCTCGAGAAGAAGGTCACATCATCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013615.1-1118s1c1
Sequence:CCGGGCTCAAGCGATCCTCCTATTTCTCGAGAAATAGGAGGATCGCTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013615.1-513s1c1
Sequence:CCGGCAGTGTCTCTATTGGCAGCTTCTCGAGAAGCTGCCAATAGAGACACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013615.1-1943s1c1
Sequence:CCGGGCCTCCATTTATTTCTCTCAACTCGAGTTGAGAGAAATAAATGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163796    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013615.1-1700s1c1
Sequence:CCGGGCTGCTAAGTGAGATCACATTCTCGAGAATGTGATCTCACTTAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013615.1-1770s1c1
Sequence:CCGGCCTGGCAGGAAAGTTTCTCATCTCGAGATGAGAAACTTTCCTGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026547
LURAP1 MISSION shRNA Bacterial Glycerol Stock
leucine rich adaptor protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026547.1-363s21c1
Sequence:CCGGGTGACCTTGAACGAGGGTATTCTCGAGAATACCCTCGTTCAAGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026547.1-997s21c1
Sequence:CCGGTGCATTTATCCCTCAATTATTCTCGAGAATAATTGAGGGATAAATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026547.1-534s21c1
Sequence:CCGGCGGCTGGACAGTGTCTCTATTCTCGAGAATAGAGACACTGTCCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026547.1-782s21c1
Sequence:CCGGCCAGGGCTTTGAAGCTCATTGCTCGAGCAATGAGCTTCAAAGCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026547.1-823s21c1
Sequence:CCGGATGATGTGACCTTCTTGTAAACTCGAGTTTACAAGAAGGTCACATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026547
LURAP1 MISSION shRNA shRNA Plasmid DNA
leucine rich adaptor protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026547.1-363s21c1
Sequence:CCGGGTGACCTTGAACGAGGGTATTCTCGAGAATACCCTCGTTCAAGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026547.1-997s21c1
Sequence:CCGGTGCATTTATCCCTCAATTATTCTCGAGAATAATTGAGGGATAAATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026547.1-534s21c1
Sequence:CCGGCGGCTGGACAGTGTCTCTATTCTCGAGAATAGAGACACTGTCCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026547.1-782s21c1
Sequence:CCGGCCAGGGCTTTGAAGCTCATTGCTCGAGCAATGAGCTTCAAAGCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026547.1-823s21c1
Sequence:CCGGATGATGTGACCTTCTTGTAAACTCGAGTTTACAAGAAGGTCACATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026547
LURAP1 MISSION shRNA Lentiviral Transduction Particles
leucine rich adaptor protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026547.1-363s21c1
Sequence:CCGGGTGACCTTGAACGAGGGTATTCTCGAGAATACCCTCGTTCAAGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026547.1-997s21c1
Sequence:CCGGTGCATTTATCCCTCAATTATTCTCGAGAATAATTGAGGGATAAATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026547.1-534s21c1
Sequence:CCGGCGGCTGGACAGTGTCTCTATTCTCGAGAATAGAGACACTGTCCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026547.1-782s21c1
Sequence:CCGGCCAGGGCTTTGAAGCTCATTGCTCGAGCAATGAGCTTCAAAGCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026547.1-823s21c1
Sequence:CCGGATGATGTGACCTTCTTGTAAACTCGAGTTTACAAGAAGGTCACATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)