EMAIL THIS PAGE TO A FRIEND

LURAP1L

leucine rich adaptor protein 1-like

96 Gene Product Result for
Synonyms: C9orf150 bA3L8.2
UniProtKB ID: Q8IV03, Q5VZX7, Q8N923, Q8NCG2
Gene ID:
Mouse(52829) leucine rich adaptor protein 1-like
Rat(362535) leucine rich adaptor protein 1-like
domestic guinea pig(100727043) leucine rich adaptor protein 1-like
naked mole-rat(101705219) leucine rich adaptor protein 1-like
sheep(101119958) leucine rich adaptor protein 1-like
domestic cat(101095445) leucine rich adaptor protein 1-like
dog(610949) leucine rich adaptor protein 1-like
cow(616371) leucine rich adaptor protein 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026821 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026821 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026821 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_203403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203403 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203403 Rosetta Predictions human pricing
NM_001025022 Rosetta Predictions rat pricing
NM_026821 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078740 predicted 1788
2 SASI_Hs01_00078741 predicted 1333
3 SASI_Hs01_00078742 predicted 1183
4 SASI_Hs01_00078743 predicted 1883
5 SASI_Hs01_00078744 predicted 1228
6 SASI_Hs01_00078745 predicted 1236
7 SASI_Hs01_00078746 predicted 1434
8 SASI_Hs01_00078747 predicted 1349
9 SASI_Hs01_00078748 predicted 1731
10 SASI_Hs01_00078749 predicted 1770
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025022 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094019 predicted 829
2 SASI_Rn01_00094020 predicted 468
3 SASI_Rn01_00094021 predicted 569
4 SASI_Rn01_00094022 predicted 436
5 SASI_Rn01_00094023 predicted 361
6 SASI_Rn01_00094024 predicted 688
7 SASI_Rn01_00094025 predicted 470
8 SASI_Rn01_00094026 predicted 400
9 SASI_Rn01_00094027 predicted 381
10 SASI_Rn01_00094028 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026821 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094673 predicted 1316
2 SASI_Mm01_00094674 predicted 1200
3 SASI_Mm01_00094675 predicted 1126
4 SASI_Mm01_00094676 predicted 1361
5 SASI_Mm01_00094677 predicted 1104
6 SASI_Mm01_00094678 predicted 940
7 SASI_Mm01_00094679 predicted 1255
8 SASI_Mm01_00094680 predicted 989
9 SASI_Mm01_00094681 predicted 1349
10 SASI_Mm01_00094682 predicted 932
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026821
VALIDATED
LURAP1L MISSION shRNA Bacterial Glycerol Stock
leucine rich adaptor protein 1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026821.5-946s21c1
Sequence:CCGGCTCAGACAGGAGATGGTTAACCTCGAGGTTAACCATCTCCTGTCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026821.5-1253s21c1
Sequence:CCGGTCAGTGACAGCTCCATCATAGCTCGAGCTATGATGGAGCTGTCACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026821.5-1316s21c1
Sequence:CCGGAGTACTACTGCTTTGGCTAATCTCGAGATTAGCCAAAGCAGTAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026821.5-1493s21c1
Sequence:CCGGTTCTCATCTAGACTGATTTATCTCGAGATAAATCAGTCTAGATGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026821.5-981s21c1
Sequence:CCGGTGTAAGGCTCATGCGTCAATTCTCGAGAATTGACGCATGAGCCTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026821
VALIDATED
LURAP1L MISSION shRNA shRNA Plasmid DNA
leucine rich adaptor protein 1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026821.5-946s21c1
Sequence:CCGGCTCAGACAGGAGATGGTTAACCTCGAGGTTAACCATCTCCTGTCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026821.5-1253s21c1
Sequence:CCGGTCAGTGACAGCTCCATCATAGCTCGAGCTATGATGGAGCTGTCACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026821.5-1316s21c1
Sequence:CCGGAGTACTACTGCTTTGGCTAATCTCGAGATTAGCCAAAGCAGTAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026821.5-1493s21c1
Sequence:CCGGTTCTCATCTAGACTGATTTATCTCGAGATAAATCAGTCTAGATGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026821.5-981s21c1
Sequence:CCGGTGTAAGGCTCATGCGTCAATTCTCGAGAATTGACGCATGAGCCTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026821
VALIDATED
LURAP1L MISSION shRNA Lentiviral Transduction Particles
leucine rich adaptor protein 1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026821.5-946s21c1
Sequence:CCGGCTCAGACAGGAGATGGTTAACCTCGAGGTTAACCATCTCCTGTCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026821.5-1253s21c1
Sequence:CCGGTCAGTGACAGCTCCATCATAGCTCGAGCTATGATGGAGCTGTCACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026821.5-1316s21c1
Sequence:CCGGAGTACTACTGCTTTGGCTAATCTCGAGATTAGCCAAAGCAGTAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026821.5-1493s21c1
Sequence:CCGGTTCTCATCTAGACTGATTTATCTCGAGATAAATCAGTCTAGATGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026821.5-981s21c1
Sequence:CCGGTGTAAGGCTCATGCGTCAATTCTCGAGAATTGACGCATGAGCCTTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203403
VALIDATED
LURAP1L MISSION shRNA Bacterial Glycerol Stock
leucine rich adaptor protein 1-like
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_203403.1-1340s1c1
Sequence:CCGGGCACTACACAAGCGTCCTAAACTCGAGTTTAGGACGCTTGTGTAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143976    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203403.1-1931s1c1
Sequence:CCGGCCACATGACAATCATCTGAAACTCGAGTTTCAGATGATTGTCATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203403.1-1351s1c1
Sequence:CCGGGCGTCCTAAATTGGATTCTGACTCGAGTCAGAATCCAATTTAGGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_203403.1-1000s1c1
Sequence:CCGGCCTCAGGCAAGAGATGGTTAACTCGAGTTAACCATCTCTTGCCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_203403.1-1288s1c1
Sequence:CCGGCCCTTCAGACTTGGACCAATTCTCGAGAATTGGTCCAAGTCTGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203403.1-1066s1c1
Sequence:CCGGCAATGAGAGCATCGAGTCCATCTCGAGATGGACTCGATGCTCTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203403.1-1368s1c1
Sequence:CCGGCTGAATACTACTGCTTTGGCTCTCGAGAGCCAAAGCAGTAGTATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203403.1-1152s1c1
Sequence:CCGGGCAGTTTGTTGGAGAGTCAGACTCGAGTCTGACTCTCCAACAAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203403.1-1057s1c1
Sequence:CCGGGCTTGTAATCAATGAGAGCATCTCGAGATGCTCTCATTGATTACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203403.1-1955s1c1
Sequence:CCGGCCCAACTATACACATTCTGTTCTCGAGAACAGAATGTGTATAGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203403.1-2392s1c1
Sequence:CCGGGCACATAGACAGTGGATATTTCTCGAGAAATATCCACTGTCTATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203403.1-1352s1c1
Sequence:CCGGCGTCCTAAATTGGATTCTGAACTCGAGTTCAGAATCCAATTTAGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203403
VALIDATED
LURAP1L MISSION shRNA shRNA Plasmid DNA
leucine rich adaptor protein 1-like
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_203403.1-1340s1c1
Sequence:CCGGGCACTACACAAGCGTCCTAAACTCGAGTTTAGGACGCTTGTGTAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143976    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203403.1-1931s1c1
Sequence:CCGGCCACATGACAATCATCTGAAACTCGAGTTTCAGATGATTGTCATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203403.1-1351s1c1
Sequence:CCGGGCGTCCTAAATTGGATTCTGACTCGAGTCAGAATCCAATTTAGGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_203403.1-1000s1c1
Sequence:CCGGCCTCAGGCAAGAGATGGTTAACTCGAGTTAACCATCTCTTGCCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_203403.1-1288s1c1
Sequence:CCGGCCCTTCAGACTTGGACCAATTCTCGAGAATTGGTCCAAGTCTGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203403.1-1066s1c1
Sequence:CCGGCAATGAGAGCATCGAGTCCATCTCGAGATGGACTCGATGCTCTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203403.1-1368s1c1
Sequence:CCGGCTGAATACTACTGCTTTGGCTCTCGAGAGCCAAAGCAGTAGTATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203403.1-1152s1c1
Sequence:CCGGGCAGTTTGTTGGAGAGTCAGACTCGAGTCTGACTCTCCAACAAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203403.1-1057s1c1
Sequence:CCGGGCTTGTAATCAATGAGAGCATCTCGAGATGCTCTCATTGATTACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203403.1-1955s1c1
Sequence:CCGGCCCAACTATACACATTCTGTTCTCGAGAACAGAATGTGTATAGTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203403.1-2392s1c1
Sequence:CCGGGCACATAGACAGTGGATATTTCTCGAGAAATATCCACTGTCTATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203403.1-1352s1c1
Sequence:CCGGCGTCCTAAATTGGATTCTGAACTCGAGTTCAGAATCCAATTTAGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203403
VALIDATED
LURAP1L MISSION shRNA Lentiviral Transduction Particles
leucine rich adaptor protein 1-like
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_203403.1-1340s1c1
Sequence:CCGGGCACTACACAAGCGTCCTAAACTCGAGTTTAGGACGCTTGTGTAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143976    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203403.1-1931s1c1
Sequence:CCGGCCACATGACAATCATCTGAAACTCGAGTTTCAGATGATTGTCATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203403.1-1351s1c1
Sequence:CCGGGCGTCCTAAATTGGATTCTGACTCGAGTCAGAATCCAATTTAGGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_203403.1-1000s1c1
Sequence:CCGGCCTCAGGCAAGAGATGGTTAACTCGAGTTAACCATCTCTTGCCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_203403.1-1288s1c1
Sequence:CCGGCCCTTCAGACTTGGACCAATTCTCGAGAATTGGTCCAAGTCTGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203403.1-1066s1c1
Sequence:CCGGCAATGAGAGCATCGAGTCCATCTCGAGATGGACTCGATGCTCTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203403.1-1368s1c1
Sequence:CCGGCTGAATACTACTGCTTTGGCTCTCGAGAGCCAAAGCAGTAGTATTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203403.1-1152s1c1
Sequence:CCGGGCAGTTTGTTGGAGAGTCAGACTCGAGTCTGACTCTCCAACAAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203403.1-1057s1c1
Sequence:CCGGGCTTGTAATCAATGAGAGCATCTCGAGATGCTCTCATTGATTACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203403.1-1955s1c1
Sequence:CCGGCCCAACTATACACATTCTGTTCTCGAGAACAGAATGTGTATAGTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203403.1-2392s1c1
Sequence:CCGGGCACATAGACAGTGGATATTTCTCGAGAAATATCCACTGTCTATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203403.1-1352s1c1
Sequence:CCGGCGTCCTAAATTGGATTCTGAACTCGAGTTCAGAATCCAATTTAGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)