EMAIL THIS PAGE TO A FRIEND

LUZP1

leucine zipper protein 1

157 Gene Product Result for
Synonyms: LUZP
UniProtKB ID: Q86V48, Q5TH93, Q8N4X3, Q8TEH1
Gene ID:
Human(7798) Summary: This gene encodes a protein that contains a leucine zipper motif. The exact function of the encoded protein is not known. In mice this gene affects neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Mouse(269593) leucine zipper protein 1
Rat(79428) leucine zipper protein 1
chicken(428210) leucine zipper protein 1
cow(516426) leucine zipper protein 1
Horse(100057968) leucine zipper protein 1
domestic cat(101096822) leucine zipper protein 1
dog(100684994) leucine zipper protein 1
sheep(101122671) leucine zipper protein 1
naked mole-rat(101707588) leucine zipper protein 1
Domestic Rabbit(100358178) leucine zipper protein 1
domestic guinea pig(100715519) leucine zipper protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033631 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024452 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024452 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024452 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU087741 MISSION® esiRNA esiRNA targeting mouse Luzp1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033631 Rosetta Predictions human pricing
NM_030830 Rosetta Predictions rat pricing
NM_024452 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361443 predicted 2745
2 SASI_Hs01_00075324 predicted 3688
3 SASI_Hs02_00361444 predicted 3673
4 SASI_Hs01_00075325 predicted 2134
5 SASI_Hs01_00075326 predicted 3200
6 SASI_Hs01_00075327 predicted 1475
7 SASI_Hs01_00075328 predicted 3116
8 SASI_Hs01_00075331 predicted 2725
9 SASI_Hs01_00075332 predicted 2464
10 SASI_Hs01_00075333 predicted 2371
11 SASI_Hs01_00075329 predicted 2428
12 SASI_Hs01_00075330 predicted 2171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030830 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264036 predicted 3007
2 SASI_Rn02_00264037 predicted 2155
3 SASI_Rn02_00264038 predicted 896
4 SASI_Rn02_00264039 predicted 1390
5 SASI_Rn02_00264040 predicted 1488
6 SASI_Rn02_00264041 predicted 3200
7 SASI_Rn02_00264042 predicted 1345
8 SASI_Rn02_00264043 predicted 2360
9 SASI_Rn02_00264044 predicted 707
10 SASI_Rn02_00264045 predicted 2533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150913 predicted 3687
2 SASI_Mm01_00150914 predicted 1508
3 SASI_Mm01_00150916 predicted 2449
4 SASI_Mm01_00150917 predicted 606
5 SASI_Mm01_00150918 predicted 733
6 SASI_Mm01_00150920 predicted 720
7 SASI_Mm01_00150922 predicted 3614
8 SASI_Mm02_00327804 predicted 1612
9 SASI_Mm02_00327805 predicted 3352
10 SASI_Mm02_00327806 predicted 1908
11 SASI_Mm01_00150915 predicted 1487
12 SASI_Mm01_00150919 predicted 3077
13 SASI_Mm01_00150921 predicted 2531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033631
VALIDATED
LUZP1 MISSION shRNA Bacterial Glycerol Stock
leucine zipper protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033631.1-410s1c1
Sequence:CCGGCGGTTTAAGCTACAGAGTCTACTCGAGTAGACTCTGTAGCTTAAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033631.1-744s1c1
Sequence:CCGGGCAGGAGTAAGAATGACTGTACTCGAGTACAGTCATTCTTACTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033631.1-1482s1c1
Sequence:CCGGCTAAGTTTAGAGGCCACGGAACTCGAGTTCCGTGGCCTCTAAACTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033631.1-1618s1c1
Sequence:CCGGGCAGGTTTCTTCTCCCAGTTTCTCGAGAAACTGGGAGAAGAAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033631.1-2129s1c1
Sequence:CCGGGCTGATAACAGTTGCCCGAATCTCGAGATTCGGGCAACTGTTATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033631.1-823s1c1
Sequence:CCGGGCTGGAAATGCTCAGAGTCAACTCGAGTTGACTCTGAGCATTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033631.1-3190s1c1
Sequence:CCGGCGTGGAATCTACCAATAGCAACTCGAGTTGCTATTGGTAGATTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033631.1-3142s1c1
Sequence:CCGGGCGAGACTTGAAATCTTTAGACTCGAGTCTAAAGATTTCAAGTCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033631.1-2466s1c1
Sequence:CCGGCCTCCCTATTTGAGAATGATACTCGAGTATCATTCTCAAATAGGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033631.3-2185s21c1
Sequence:CCGGGTTCTATCGAAGTATCCTTATCTCGAGATAAGGATACTTCGATAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033631.3-3781s21c1
Sequence:CCGGGAGGGAATCAGAGACTACAAGCTCGAGCTTGTAGTCTCTGATTCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033631.3-3995s21c1
Sequence:CCGGTGTGGTTAATGTTCTGGTTTCCTCGAGGAAACCAGAACATTAACCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033631
VALIDATED
LUZP1 MISSION shRNA shRNA Plasmid DNA
leucine zipper protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033631.1-410s1c1
Sequence:CCGGCGGTTTAAGCTACAGAGTCTACTCGAGTAGACTCTGTAGCTTAAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033631.1-744s1c1
Sequence:CCGGGCAGGAGTAAGAATGACTGTACTCGAGTACAGTCATTCTTACTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033631.1-1482s1c1
Sequence:CCGGCTAAGTTTAGAGGCCACGGAACTCGAGTTCCGTGGCCTCTAAACTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033631.1-1618s1c1
Sequence:CCGGGCAGGTTTCTTCTCCCAGTTTCTCGAGAAACTGGGAGAAGAAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033631.1-2129s1c1
Sequence:CCGGGCTGATAACAGTTGCCCGAATCTCGAGATTCGGGCAACTGTTATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033631.1-823s1c1
Sequence:CCGGGCTGGAAATGCTCAGAGTCAACTCGAGTTGACTCTGAGCATTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033631.1-3190s1c1
Sequence:CCGGCGTGGAATCTACCAATAGCAACTCGAGTTGCTATTGGTAGATTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033631.1-3142s1c1
Sequence:CCGGGCGAGACTTGAAATCTTTAGACTCGAGTCTAAAGATTTCAAGTCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033631.1-2466s1c1
Sequence:CCGGCCTCCCTATTTGAGAATGATACTCGAGTATCATTCTCAAATAGGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033631.3-2185s21c1
Sequence:CCGGGTTCTATCGAAGTATCCTTATCTCGAGATAAGGATACTTCGATAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033631.3-3781s21c1
Sequence:CCGGGAGGGAATCAGAGACTACAAGCTCGAGCTTGTAGTCTCTGATTCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033631.3-3995s21c1
Sequence:CCGGTGTGGTTAATGTTCTGGTTTCCTCGAGGAAACCAGAACATTAACCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033631
VALIDATED
LUZP1 MISSION shRNA Lentiviral Transduction Particles
leucine zipper protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033631.1-410s1c1
Sequence:CCGGCGGTTTAAGCTACAGAGTCTACTCGAGTAGACTCTGTAGCTTAAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033631.1-744s1c1
Sequence:CCGGGCAGGAGTAAGAATGACTGTACTCGAGTACAGTCATTCTTACTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033631.1-1482s1c1
Sequence:CCGGCTAAGTTTAGAGGCCACGGAACTCGAGTTCCGTGGCCTCTAAACTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033631.1-1618s1c1
Sequence:CCGGGCAGGTTTCTTCTCCCAGTTTCTCGAGAAACTGGGAGAAGAAACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033631.1-2129s1c1
Sequence:CCGGGCTGATAACAGTTGCCCGAATCTCGAGATTCGGGCAACTGTTATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033631.1-823s1c1
Sequence:CCGGGCTGGAAATGCTCAGAGTCAACTCGAGTTGACTCTGAGCATTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033631.1-3190s1c1
Sequence:CCGGCGTGGAATCTACCAATAGCAACTCGAGTTGCTATTGGTAGATTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033631.1-3142s1c1
Sequence:CCGGGCGAGACTTGAAATCTTTAGACTCGAGTCTAAAGATTTCAAGTCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033631.1-2466s1c1
Sequence:CCGGCCTCCCTATTTGAGAATGATACTCGAGTATCATTCTCAAATAGGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033631.3-2185s21c1
Sequence:CCGGGTTCTATCGAAGTATCCTTATCTCGAGATAAGGATACTTCGATAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033631.3-3781s21c1
Sequence:CCGGGAGGGAATCAGAGACTACAAGCTCGAGCTTGTAGTCTCTGATTCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033631.3-3995s21c1
Sequence:CCGGTGTGGTTAATGTTCTGGTTTCCTCGAGGAAACCAGAACATTAACCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024452
LUZP1 MISSION shRNA Bacterial Glycerol Stock
leucine zipper protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024452.1-2609s1c1
Sequence:CCGGCCACCTCTAAATCTGTGACAACTCGAGTTGTCACAGATTTAGAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024452.2-737s1c1
Sequence:CCGGCAGAAACGAATGGTTGATTTACTCGAGTAAATCAACCATTCGTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024452.2-4003s1c1
Sequence:CCGGGATTTGTCTCCTCACTATATCCTCGAGGATATAGTGAGGAGACAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024452.2-3739s21c1
Sequence:CCGGAGGCTATGGCTCAGGTAATTTCTCGAGAAATTACCTGAGCCATAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024452.2-2496s21c1
Sequence:CCGGGAACTAGAACTGCCCTATTTGCTCGAGCAAATAGGGCAGTTCTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024452.2-433s21c1
Sequence:CCGGCAACCGCCACCTGCGATTTAACTCGAGTTAAATCGCAGGTGGCGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024452.2-1119s21c1
Sequence:CCGGTACGGATAGAGGACGGCATTTCTCGAGAAATGCCGTCCTCTATCCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024452.2-2649s21c1
Sequence:CCGGTGCGGTCTAGAGCAATTATAACTCGAGTTATAATTGCTCTAGACCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024452
LUZP1 MISSION shRNA shRNA Plasmid DNA
leucine zipper protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024452.1-2609s1c1
Sequence:CCGGCCACCTCTAAATCTGTGACAACTCGAGTTGTCACAGATTTAGAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024452.2-737s1c1
Sequence:CCGGCAGAAACGAATGGTTGATTTACTCGAGTAAATCAACCATTCGTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024452.2-4003s1c1
Sequence:CCGGGATTTGTCTCCTCACTATATCCTCGAGGATATAGTGAGGAGACAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024452.2-3739s21c1
Sequence:CCGGAGGCTATGGCTCAGGTAATTTCTCGAGAAATTACCTGAGCCATAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024452.2-2496s21c1
Sequence:CCGGGAACTAGAACTGCCCTATTTGCTCGAGCAAATAGGGCAGTTCTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024452.2-433s21c1
Sequence:CCGGCAACCGCCACCTGCGATTTAACTCGAGTTAAATCGCAGGTGGCGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024452.2-1119s21c1
Sequence:CCGGTACGGATAGAGGACGGCATTTCTCGAGAAATGCCGTCCTCTATCCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024452.2-2649s21c1
Sequence:CCGGTGCGGTCTAGAGCAATTATAACTCGAGTTATAATTGCTCTAGACCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024452
LUZP1 MISSION shRNA Lentiviral Transduction Particles
leucine zipper protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024452.1-2609s1c1
Sequence:CCGGCCACCTCTAAATCTGTGACAACTCGAGTTGTCACAGATTTAGAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024452.2-737s1c1
Sequence:CCGGCAGAAACGAATGGTTGATTTACTCGAGTAAATCAACCATTCGTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024452.2-4003s1c1
Sequence:CCGGGATTTGTCTCCTCACTATATCCTCGAGGATATAGTGAGGAGACAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024452.2-3739s21c1
Sequence:CCGGAGGCTATGGCTCAGGTAATTTCTCGAGAAATTACCTGAGCCATAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024452.2-2496s21c1
Sequence:CCGGGAACTAGAACTGCCCTATTTGCTCGAGCAAATAGGGCAGTTCTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024452.2-433s21c1
Sequence:CCGGCAACCGCCACCTGCGATTTAACTCGAGTTAAATCGCAGGTGGCGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024452.2-1119s21c1
Sequence:CCGGTACGGATAGAGGACGGCATTTCTCGAGAAATGCCGTCCTCTATCCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024452.2-2649s21c1
Sequence:CCGGTGCGGTCTAGAGCAATTATAACTCGAGTTATAATTGCTCTAGACCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)