EMAIL THIS PAGE TO A FRIEND

LUZP2

leucine zipper protein 2

120 Gene Product Result for
Synonyms: KFSP2566 PRO6246
UniProtKB ID: Q86TE4, A2RUB8, E9PN53, Q6UXE7, Q6ZS65
Gene ID:
Human(338645) Summary: This gene encodes a leucine zipper protein. This protein is deleted in some patients with Wilms tumor-Aniridia-Genitourinary anomalies-mental Retardation (WAGR) syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Mouse(233271) leucine zipper protein 2
domestic guinea pig(100726918) leucine zipper protein 2
naked mole-rat(101700662) leucine zipper protein 2
sheep(101118830) leucine zipper protein 2
chicken(423001) leucine zipper protein 2
cow(785165) leucine zipper protein 2
dog(612193) leucine zipper protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178705 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178705 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178705 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001009909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009909 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015121 MISSION® esiRNA esiRNA targeting human LUZP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009909 Rosetta Predictions human pricing
NM_178705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177977 predicted 401
2 SASI_Hs02_00305710 predicted 1300
3 SASI_Hs01_00177981 predicted 380
4 SASI_Hs01_00177982 predicted 1331
5 SASI_Hs01_00177983 predicted 1173
6 SASI_Hs01_00177984 predicted 371
7 SASI_Hs02_00305711 predicted 937
8 SASI_Hs02_00305712 predicted 1000
9 SASI_Hs02_00305713 predicted 958
10 SASI_Hs02_00305714 predicted 441
11 SASI_Hs01_00177978 predicted 1505
12 SASI_Hs01_00177979 predicted 1533
13 SASI_Hs01_00177980 predicted 1524
14 SASI_Hs01_00177985 predicted 1525
15 SASI_Hs01_00177986 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141881 predicted 997
2 SASI_Mm01_00141883 predicted 937
3 SASI_Mm01_00141884 predicted 1658
4 SASI_Mm01_00141886 predicted 1380
5 SASI_Mm01_00141887 predicted 1140
6 SASI_Mm02_00349206 predicted 1430
7 SASI_Mm02_00349207 predicted 815
8 SASI_Mm02_00349208 predicted 1338
9 SASI_Mm02_00349209 predicted 994
10 SASI_Mm02_00349210 predicted 1772
11 SASI_Mm01_00141879 predicted 1362
12 SASI_Mm01_00141880 predicted 1820
13 SASI_Mm01_00141882 predicted 1090
14 SASI_Mm01_00141885 predicted 1815
15 SASI_Mm01_00141888 predicted 1430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178705
LUZP2 MISSION shRNA Bacterial Glycerol Stock
leucine zipper protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178705.5-2653s1c1
Sequence:CCGGGAGCTAGACTGTGGCATAATTCTCGAGAATTATGCCACAGTCTAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178705.4-1219s1c1
Sequence:CCGGGATTTGTTATTTAAGGCCCAACTCGAGTTGGGCCTTAAATAACAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178705.4-4212s1c1
Sequence:CCGGCCTTTGAGAATGGGATTGAAACTCGAGTTTCAATCCCATTCTCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178705.4-1395s1c1
Sequence:CCGGGCCATCAAATCCAACCCAGATCTCGAGATCTGGGTTGGATTTGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178705.4-1200s1c1
Sequence:CCGGGCTCCGTTATGGGAAGAAAGACTCGAGTCTTTCTTCCCATAACGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178705.5-1638s1c1
Sequence:CCGGCACAACACAGAAATTACAAATCTCGAGATTTGTAATTTCTGTGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178705.4-1324s1c1
Sequence:CCGGGCAATGAAAGAGACCGTACAACTCGAGTTGTACGGTCTCTTTCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178705.4-1556s1c1
Sequence:CCGGGTCCTCAAGATGAGGGTAGTTCTCGAGAACTACCCTCATCTTGAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178705
LUZP2 MISSION shRNA shRNA Plasmid DNA
leucine zipper protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178705.5-2653s1c1
Sequence:CCGGGAGCTAGACTGTGGCATAATTCTCGAGAATTATGCCACAGTCTAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178705.4-1219s1c1
Sequence:CCGGGATTTGTTATTTAAGGCCCAACTCGAGTTGGGCCTTAAATAACAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178705.4-4212s1c1
Sequence:CCGGCCTTTGAGAATGGGATTGAAACTCGAGTTTCAATCCCATTCTCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178705.4-1395s1c1
Sequence:CCGGGCCATCAAATCCAACCCAGATCTCGAGATCTGGGTTGGATTTGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178705.4-1200s1c1
Sequence:CCGGGCTCCGTTATGGGAAGAAAGACTCGAGTCTTTCTTCCCATAACGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178705.5-1638s1c1
Sequence:CCGGCACAACACAGAAATTACAAATCTCGAGATTTGTAATTTCTGTGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178705.4-1324s1c1
Sequence:CCGGGCAATGAAAGAGACCGTACAACTCGAGTTGTACGGTCTCTTTCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178705.4-1556s1c1
Sequence:CCGGGTCCTCAAGATGAGGGTAGTTCTCGAGAACTACCCTCATCTTGAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178705
LUZP2 MISSION shRNA Lentiviral Transduction Particles
leucine zipper protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178705.5-2653s1c1
Sequence:CCGGGAGCTAGACTGTGGCATAATTCTCGAGAATTATGCCACAGTCTAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178705.4-1219s1c1
Sequence:CCGGGATTTGTTATTTAAGGCCCAACTCGAGTTGGGCCTTAAATAACAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178705.4-4212s1c1
Sequence:CCGGCCTTTGAGAATGGGATTGAAACTCGAGTTTCAATCCCATTCTCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178705.4-1395s1c1
Sequence:CCGGGCCATCAAATCCAACCCAGATCTCGAGATCTGGGTTGGATTTGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178705.4-1200s1c1
Sequence:CCGGGCTCCGTTATGGGAAGAAAGACTCGAGTCTTTCTTCCCATAACGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178705.5-1638s1c1
Sequence:CCGGCACAACACAGAAATTACAAATCTCGAGATTTGTAATTTCTGTGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178705.4-1324s1c1
Sequence:CCGGGCAATGAAAGAGACCGTACAACTCGAGTTGTACGGTCTCTTTCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178705.4-1556s1c1
Sequence:CCGGGTCCTCAAGATGAGGGTAGTTCTCGAGAACTACCCTCATCTTGAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009909
LUZP2 MISSION shRNA Bacterial Glycerol Stock
leucine zipper protein 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-195s1c1
Sequence:CCGGGCTGAAAGAAGTCTTTAAGGACTCGAGTCCTTAAAGACTTCTTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-403s1c1
Sequence:CCGGGAGACATCAGAGAAAGCAGAACTCGAGTTCTGCTTTCTCTGATGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-492s1c1
Sequence:CCGGCCAGAATGAGGATTCAAGGAACTCGAGTTCCTTGAATCCTCATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-169s1c1
Sequence:CCGGCAGGACTATGAAGAGCTAGAACTCGAGTTCTAGCTCTTCATAGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-325s1c1
Sequence:CCGGCAGAAACTTCTGGAATTAGGACTCGAGTCCTAATTCCAGAAGTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-248s1c1
Sequence:CCGGCATCAAGAGAACTTGATGGAACTCGAGTTCCATCAAGTTCTCTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-319s1c1
Sequence:CCGGGATGTTCAGAAACTTCTGGAACTCGAGTTCCAGAAGTTTCTGAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-455s1c1
Sequence:CCGGCTGAAGTTGAAAGAAAGAGCACTCGAGTGCTCTTTCTTTCAACTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-251s1c1
Sequence:CCGGCAAGAGAACTTGATGGAATTACTCGAGTAATTCCATCAAGTTCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-192s1c1
Sequence:CCGGGCAGCTGAAAGAAGTCTTTAACTCGAGTTAAAGACTTCTTTCAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-331s1c1
Sequence:CCGGCTTCTGGAATTAGGACAGAAACTCGAGTTTCTGTCCTAATTCCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-397s1c1
Sequence:CCGGCTTAAGGAGACATCAGAGAAACTCGAGTTTCTCTGATGTCTCCTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-396s1c1
Sequence:CCGGGCTTAAGGAGACATCAGAGAACTCGAGTTCTCTGATGTCTCCTTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-224s1c1
Sequence:CCGGCCATTCTTCGTCAGCTGACAACTCGAGTTGTCAGCTGACGAAGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009909
LUZP2 MISSION shRNA shRNA Plasmid DNA
leucine zipper protein 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-195s1c1
Sequence:CCGGGCTGAAAGAAGTCTTTAAGGACTCGAGTCCTTAAAGACTTCTTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-403s1c1
Sequence:CCGGGAGACATCAGAGAAAGCAGAACTCGAGTTCTGCTTTCTCTGATGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-492s1c1
Sequence:CCGGCCAGAATGAGGATTCAAGGAACTCGAGTTCCTTGAATCCTCATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-169s1c1
Sequence:CCGGCAGGACTATGAAGAGCTAGAACTCGAGTTCTAGCTCTTCATAGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-325s1c1
Sequence:CCGGCAGAAACTTCTGGAATTAGGACTCGAGTCCTAATTCCAGAAGTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-248s1c1
Sequence:CCGGCATCAAGAGAACTTGATGGAACTCGAGTTCCATCAAGTTCTCTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-319s1c1
Sequence:CCGGGATGTTCAGAAACTTCTGGAACTCGAGTTCCAGAAGTTTCTGAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-455s1c1
Sequence:CCGGCTGAAGTTGAAAGAAAGAGCACTCGAGTGCTCTTTCTTTCAACTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-251s1c1
Sequence:CCGGCAAGAGAACTTGATGGAATTACTCGAGTAATTCCATCAAGTTCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-192s1c1
Sequence:CCGGGCAGCTGAAAGAAGTCTTTAACTCGAGTTAAAGACTTCTTTCAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-331s1c1
Sequence:CCGGCTTCTGGAATTAGGACAGAAACTCGAGTTTCTGTCCTAATTCCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-397s1c1
Sequence:CCGGCTTAAGGAGACATCAGAGAAACTCGAGTTTCTCTGATGTCTCCTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-396s1c1
Sequence:CCGGGCTTAAGGAGACATCAGAGAACTCGAGTTCTCTGATGTCTCCTTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-224s1c1
Sequence:CCGGCCATTCTTCGTCAGCTGACAACTCGAGTTGTCAGCTGACGAAGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009909
LUZP2 MISSION shRNA Lentiviral Transduction Particles
leucine zipper protein 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-195s1c1
Sequence:CCGGGCTGAAAGAAGTCTTTAAGGACTCGAGTCCTTAAAGACTTCTTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-403s1c1
Sequence:CCGGGAGACATCAGAGAAAGCAGAACTCGAGTTCTGCTTTCTCTGATGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-492s1c1
Sequence:CCGGCCAGAATGAGGATTCAAGGAACTCGAGTTCCTTGAATCCTCATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-169s1c1
Sequence:CCGGCAGGACTATGAAGAGCTAGAACTCGAGTTCTAGCTCTTCATAGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-325s1c1
Sequence:CCGGCAGAAACTTCTGGAATTAGGACTCGAGTCCTAATTCCAGAAGTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-248s1c1
Sequence:CCGGCATCAAGAGAACTTGATGGAACTCGAGTTCCATCAAGTTCTCTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-319s1c1
Sequence:CCGGGATGTTCAGAAACTTCTGGAACTCGAGTTCCAGAAGTTTCTGAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-455s1c1
Sequence:CCGGCTGAAGTTGAAAGAAAGAGCACTCGAGTGCTCTTTCTTTCAACTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-251s1c1
Sequence:CCGGCAAGAGAACTTGATGGAATTACTCGAGTAATTCCATCAAGTTCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-192s1c1
Sequence:CCGGGCAGCTGAAAGAAGTCTTTAACTCGAGTTAAAGACTTCTTTCAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-331s1c1
Sequence:CCGGCTTCTGGAATTAGGACAGAAACTCGAGTTTCTGTCCTAATTCCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-397s1c1
Sequence:CCGGCTTAAGGAGACATCAGAGAAACTCGAGTTTCTCTGATGTCTCCTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-396s1c1
Sequence:CCGGGCTTAAGGAGACATCAGAGAACTCGAGTTCTCTGATGTCTCCTTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009909.1-224s1c1
Sequence:CCGGCCATTCTTCGTCAGCTGACAACTCGAGTTGTCAGCTGACGAAGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)