EMAIL THIS PAGE TO A FRIEND

LUZP6

leucine zipper protein 6

5 Gene Product Result for
Synonyms: MPD6 MTPNUT
Species: Human LUZP6(767558), cow LUZP6(101903959), domestic guinea pig Luzp6(101787045)
UniProtKB ID: Q538Z0
Gene ID:
Human(767558) Summary: A bi-cistronic transcript encodes the products of both the myotrophin and leucine zipper protein 6 genes, which are located on chromosome 7. A cryptic ORF at the 3' end of the myotrophin transcript uses a novel internal ribosome entry site and a non-AUG translation initiation codon to produce leucine zipper protein 6, a 6.4 kDa tumor antigen that is associated with myeloproliferative disease. [provided by RefSeq, Jul 2008]
cow(101903959) leucine zipper protein 6
domestic guinea pig(101787045) leucine zipper protein 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA077907 Anti-LUZP6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001128619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001128619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001128619 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128619
LUZP6 MISSION shRNA Bacterial Glycerol Stock
leucine zipper protein 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128619.1-3574s21c1
Sequence:CCGGTGAGAGTGCCCTCCTACATAACTCGAGTTATGTAGGAGGGCACTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128619.1-3293s21c1
Sequence:CCGGCTATAGGCTTATCGTTCAAATCTCGAGATTTGAACGATAAGCCTATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128619.1-3219s21c1
Sequence:CCGGCAAGTACAAACAGGTAGTTTACTCGAGTAAACTACCTGTTTGTACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128619.1-3246s21c1
Sequence:CCGGTATAGTAGTGTACTAACAAAGCTCGAGCTTTGTTAGTACACTACTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128619.1-3346s21c1
Sequence:CCGGCGCATAGCTCACCTTTCTAAACTCGAGTTTAGAAAGGTGAGCTATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128619
LUZP6 MISSION shRNA shRNA Plasmid DNA
leucine zipper protein 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128619.1-3574s21c1
Sequence:CCGGTGAGAGTGCCCTCCTACATAACTCGAGTTATGTAGGAGGGCACTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128619.1-3293s21c1
Sequence:CCGGCTATAGGCTTATCGTTCAAATCTCGAGATTTGAACGATAAGCCTATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128619.1-3219s21c1
Sequence:CCGGCAAGTACAAACAGGTAGTTTACTCGAGTAAACTACCTGTTTGTACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128619.1-3246s21c1
Sequence:CCGGTATAGTAGTGTACTAACAAAGCTCGAGCTTTGTTAGTACACTACTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128619.1-3346s21c1
Sequence:CCGGCGCATAGCTCACCTTTCTAAACTCGAGTTTAGAAAGGTGAGCTATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128619
LUZP6 MISSION shRNA Lentiviral Transduction Particles
leucine zipper protein 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128619.1-3574s21c1
Sequence:CCGGTGAGAGTGCCCTCCTACATAACTCGAGTTATGTAGGAGGGCACTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128619.1-3293s21c1
Sequence:CCGGCTATAGGCTTATCGTTCAAATCTCGAGATTTGAACGATAAGCCTATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128619.1-3219s21c1
Sequence:CCGGCAAGTACAAACAGGTAGTTTACTCGAGTAAACTACCTGTTTGTACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128619.1-3246s21c1
Sequence:CCGGTATAGTAGTGTACTAACAAAGCTCGAGCTTTGTTAGTACACTACTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128619.1-3346s21c1
Sequence:CCGGCGCATAGCTCACCTTTCTAAACTCGAGTTTAGAAAGGTGAGCTATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)