EMAIL THIS PAGE TO A FRIEND

LXN

latexin

58 Gene Product Result for
Synonyms: ECI TCI
UniProtKB ID: Q9BS40, Q96PN2, Q9NQS6
Gene ID:
Human(56925) Summary: This gene encodes the only known protein inhibitor of zinc-dependent metallocarboxypeptidases. [provided by RefSeq, Oct 2008]
Mouse(17035) latexin
Rat(59073) latexin
Goat(100861135) latexin
chicken(771519) latexin
dog(610062) latexin
cow(781644) latexin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020169 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020169 Rosetta Predictions human pricing
NM_031655 Rosetta Predictions rat pricing
NM_016753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073945 predicted 857
2 SASI_Hs01_00073946 predicted 864
3 SASI_Hs01_00073947 predicted 256
4 SASI_Hs01_00073948 predicted 816
5 SASI_Hs01_00073949 predicted 822
6 SASI_Hs01_00073950 predicted 404
7 SASI_Hs01_00073952 predicted 640
8 SASI_Hs02_00353078 predicted 540
9 SASI_Hs02_00353079 predicted 553
10 SASI_Hs02_00353080 predicted 341
11 SASI_Hs01_00073943 predicted 893
12 SASI_Hs01_00073944 predicted 736
13 SASI_Hs01_00073951 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055801 predicted 318
2 SASI_Rn01_00055802 predicted 544
3 SASI_Rn01_00055804 predicted 815
4 SASI_Rn02_00264992 predicted 213
5 SASI_Rn02_00264993 predicted 683
6 SASI_Rn02_00264994 predicted 629
7 SASI_Rn01_00055805 predicted 334
8 SASI_Rn01_00055806 predicted 497
9 SASI_Rn01_00055807 predicted 417
10 SASI_Rn01_00055808 predicted 705
11 SASI_Rn01_00055799 predicted 724
12 SASI_Rn01_00055800 predicted 586
13 SASI_Rn01_00055803 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179145 predicted 699
2 SASI_Mm01_00179146 predicted 726
3 SASI_Mm01_00179147 predicted 864
4 SASI_Mm02_00323488 predicted 455
5 SASI_Mm01_00179148 predicted 636
6 SASI_Mm01_00179149 predicted 386
7 SASI_Mm01_00179150 predicted 761
8 SASI_Mm01_00179151 predicted 378
9 SASI_Mm02_00323489 predicted 633
10 SASI_Mm01_00179152 predicted 622
11 SASI_Mm01_00179153 predicted 739
12 SASI_Mm01_00179154 predicted 793
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016753
VALIDATED
LXN MISSION shRNA Bacterial Glycerol Stock
latexin
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016753.4-239s21c1
Sequence:CCGGGTGGCGGAGAACTGCATTAACCTCGAGGTTAATGCAGTTCTCCGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016753.4-875s21c1
Sequence:CCGGCCCGTAGACAACCGTCAGCATCTCGAGATGCTGACGGTTGTCTACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016753.4-625s21c1
Sequence:CCGGCGGTTATGTAATGTGGCAGAACTCGAGTTCTGCCACATTACATAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016753.4-363s21c1
Sequence:CCGGCTGTGGAAGAAATTATCCAAACTCGAGTTTGGATAATTTCTTCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016753.4-752s21c1
Sequence:CCGGATTGCATCGCAGGAGATTATTCTCGAGAATAATCTCCTGCGATGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016753.4-648s21c1
Sequence:CCGGCGACTGAAGACACATGGTATACTCGAGTATACCATGTGTCTTCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016753.2-876s1c1
Sequence:CCGGCCCGTAGACAACCGTCAGCATCTCGAGATGCTGACGGTTGTCTACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016753.2-628s1c1
Sequence:CCGGGTTATGTAATGTGGCAGAATTCTCGAGAATTCTGCCACATTACATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016753.2-649s1c1
Sequence:CCGGCGACTGAAGACACATGGTATACTCGAGTATACCATGTGTCTTCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016753.2-364s1c1
Sequence:CCGGCTGTGGAAGAAATTATCCAAACTCGAGTTTGGATAATTTCTTCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016753.2-626s1c1
Sequence:CCGGCGGTTATGTAATGTGGCAGAACTCGAGTTCTGCCACATTACATAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016753
VALIDATED
LXN MISSION shRNA shRNA Plasmid DNA
latexin
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016753.4-239s21c1
Sequence:CCGGGTGGCGGAGAACTGCATTAACCTCGAGGTTAATGCAGTTCTCCGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016753.4-875s21c1
Sequence:CCGGCCCGTAGACAACCGTCAGCATCTCGAGATGCTGACGGTTGTCTACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016753.4-625s21c1
Sequence:CCGGCGGTTATGTAATGTGGCAGAACTCGAGTTCTGCCACATTACATAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016753.4-363s21c1
Sequence:CCGGCTGTGGAAGAAATTATCCAAACTCGAGTTTGGATAATTTCTTCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016753.4-752s21c1
Sequence:CCGGATTGCATCGCAGGAGATTATTCTCGAGAATAATCTCCTGCGATGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016753.4-648s21c1
Sequence:CCGGCGACTGAAGACACATGGTATACTCGAGTATACCATGTGTCTTCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016753.2-876s1c1
Sequence:CCGGCCCGTAGACAACCGTCAGCATCTCGAGATGCTGACGGTTGTCTACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016753.2-628s1c1
Sequence:CCGGGTTATGTAATGTGGCAGAATTCTCGAGAATTCTGCCACATTACATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016753.2-649s1c1
Sequence:CCGGCGACTGAAGACACATGGTATACTCGAGTATACCATGTGTCTTCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016753.2-364s1c1
Sequence:CCGGCTGTGGAAGAAATTATCCAAACTCGAGTTTGGATAATTTCTTCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016753.2-626s1c1
Sequence:CCGGCGGTTATGTAATGTGGCAGAACTCGAGTTCTGCCACATTACATAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016753
VALIDATED
LXN MISSION shRNA Lentiviral Transduction Particles
latexin
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016753.4-239s21c1
Sequence:CCGGGTGGCGGAGAACTGCATTAACCTCGAGGTTAATGCAGTTCTCCGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016753.4-875s21c1
Sequence:CCGGCCCGTAGACAACCGTCAGCATCTCGAGATGCTGACGGTTGTCTACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016753.4-625s21c1
Sequence:CCGGCGGTTATGTAATGTGGCAGAACTCGAGTTCTGCCACATTACATAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016753.4-363s21c1
Sequence:CCGGCTGTGGAAGAAATTATCCAAACTCGAGTTTGGATAATTTCTTCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016753.4-752s21c1
Sequence:CCGGATTGCATCGCAGGAGATTATTCTCGAGAATAATCTCCTGCGATGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016753.4-648s21c1
Sequence:CCGGCGACTGAAGACACATGGTATACTCGAGTATACCATGTGTCTTCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016753.2-876s1c1
Sequence:CCGGCCCGTAGACAACCGTCAGCATCTCGAGATGCTGACGGTTGTCTACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016753.2-628s1c1
Sequence:CCGGGTTATGTAATGTGGCAGAATTCTCGAGAATTCTGCCACATTACATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016753.2-649s1c1
Sequence:CCGGCGACTGAAGACACATGGTATACTCGAGTATACCATGTGTCTTCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016753.2-364s1c1
Sequence:CCGGCTGTGGAAGAAATTATCCAAACTCGAGTTTGGATAATTTCTTCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016753.2-626s1c1
Sequence:CCGGCGGTTATGTAATGTGGCAGAACTCGAGTTCTGCCACATTACATAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020169
VALIDATED
LXN MISSION shRNA Bacterial Glycerol Stock
latexin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020169.3-620s21c1
Sequence:CCGGCGTTCTACATTTAGCCTGGGTCTCGAGACCCAGGCTAAATGTAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_020169.3-819s21c1
Sequence:CCGGCATCCACAATACGGCACTAAACTCGAGTTTAGTGCCGTATTGTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290056    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020169.3-892s21c1
Sequence:CCGGCCCTAACACTGGAAGTGTAAACTCGAGTTTACACTTCCAGTGTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020169.3-468s21c1
Sequence:CCGGCCAGAAGTCAACTTCACATTTCTCGAGAAATGTGAAGTTGACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020169.2-892s1c1
Sequence:CCGGCCCTAACACTGGAAGTGTAAACTCGAGTTTACACTTCCAGTGTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020169.2-471s1c1
Sequence:CCGGGAAGTCAACTTCACATTTGAACTCGAGTTCAAATGTGAAGTTGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020169.2-620s1c1
Sequence:CCGGCGTTCTACATTTAGCCTGGGTCTCGAGACCCAGGCTAAATGTAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020169.2-468s1c1
Sequence:CCGGCCAGAAGTCAACTTCACATTTCTCGAGAAATGTGAAGTTGACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020169.2-819s1c1
Sequence:CCGGCATCCACAATACGGCACTAAACTCGAGTTTAGTGCCGTATTGTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020169
VALIDATED
LXN MISSION shRNA shRNA Plasmid DNA
latexin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020169.3-620s21c1
Sequence:CCGGCGTTCTACATTTAGCCTGGGTCTCGAGACCCAGGCTAAATGTAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_020169.3-819s21c1
Sequence:CCGGCATCCACAATACGGCACTAAACTCGAGTTTAGTGCCGTATTGTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290056    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020169.3-892s21c1
Sequence:CCGGCCCTAACACTGGAAGTGTAAACTCGAGTTTACACTTCCAGTGTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020169.3-468s21c1
Sequence:CCGGCCAGAAGTCAACTTCACATTTCTCGAGAAATGTGAAGTTGACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020169.2-892s1c1
Sequence:CCGGCCCTAACACTGGAAGTGTAAACTCGAGTTTACACTTCCAGTGTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020169.2-471s1c1
Sequence:CCGGGAAGTCAACTTCACATTTGAACTCGAGTTCAAATGTGAAGTTGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020169.2-620s1c1
Sequence:CCGGCGTTCTACATTTAGCCTGGGTCTCGAGACCCAGGCTAAATGTAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020169.2-468s1c1
Sequence:CCGGCCAGAAGTCAACTTCACATTTCTCGAGAAATGTGAAGTTGACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020169.2-819s1c1
Sequence:CCGGCATCCACAATACGGCACTAAACTCGAGTTTAGTGCCGTATTGTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020169
VALIDATED
LXN MISSION shRNA Lentiviral Transduction Particles
latexin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020169.3-620s21c1
Sequence:CCGGCGTTCTACATTTAGCCTGGGTCTCGAGACCCAGGCTAAATGTAGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_020169.3-819s21c1
Sequence:CCGGCATCCACAATACGGCACTAAACTCGAGTTTAGTGCCGTATTGTGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290056    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020169.3-892s21c1
Sequence:CCGGCCCTAACACTGGAAGTGTAAACTCGAGTTTACACTTCCAGTGTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020169.3-468s21c1
Sequence:CCGGCCAGAAGTCAACTTCACATTTCTCGAGAAATGTGAAGTTGACTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020169.2-892s1c1
Sequence:CCGGCCCTAACACTGGAAGTGTAAACTCGAGTTTACACTTCCAGTGTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020169.2-471s1c1
Sequence:CCGGGAAGTCAACTTCACATTTGAACTCGAGTTCAAATGTGAAGTTGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020169.2-620s1c1
Sequence:CCGGCGTTCTACATTTAGCCTGGGTCTCGAGACCCAGGCTAAATGTAGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020169.2-468s1c1
Sequence:CCGGCCAGAAGTCAACTTCACATTTCTCGAGAAATGTGAAGTTGACTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020169.2-819s1c1
Sequence:CCGGCATCCACAATACGGCACTAAACTCGAGTTTAGTGCCGTATTGTGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)