EMAIL THIS PAGE TO A FRIEND

LY6D

lymphocyte antigen 6 complex, locus D

56 Gene Product Result for
Synonyms: E48 Ly-6D
Gene ID:
Mouse(17068) lymphocyte antigen 6 complex, locus D
Rat(315075) lymphocyte antigen 6 complex, locus D
sheep(101118961) lymphocyte antigen 6 complex, locus D
naked mole-rat(101702244) lymphocyte antigen 6 complex, locus D
cow(785796) lymphocyte antigen 6D-like
cow(618714) lymphocyte antigen 6 complex, locus D
dog(609112) lymphocyte antigen 6 complex, locus D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010742 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010742 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010742 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003695 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003695 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003695 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023341 MISSION® esiRNA esiRNA human LY6D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003695 Rosetta Predictions human pricing
NM_001130552 Rosetta Predictions rat pricing
XM_235420 Rosetta Predictions rat pricing
NM_010742 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045652 predicted 422
2 SASI_Hs01_00045653 predicted 334
3 SASI_Hs01_00045655 predicted 304
4 SASI_Hs01_00045656 predicted 339
5 SASI_Hs01_00045657 predicted 348
6 SASI_Hs01_00045658 predicted 280
7 SASI_Hs01_00045654 predicted 217
8 SASI_Hs01_00045659 predicted 332
9 SASI_Hs01_00045660 predicted 256
10 SASI_Hs01_00045661 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130552 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255689 predicted 305
2 SASI_Rn02_00255690 predicted 292
3 SASI_Rn02_00255691 predicted 324
4 SASI_Rn02_00255692 predicted 415
5 SASI_Rn02_00255693 predicted 406
6 SASI_Rn02_00255694 predicted 482
7 SASI_Rn02_00255695 predicted 410
8 SASI_Rn02_00255696 predicted 323
9 SASI_Rn02_00255697 predicted 325
10 SASI_Rn02_00255698 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235420 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184937 predicted 466
2 SASI_Rn01_00184938 predicted 398
3 SASI_Rn01_00184939 predicted 376
4 SASI_Rn01_00184940 predicted 398
5 SASI_Rn01_00184941 predicted 388
6 SASI_Rn01_00184942 predicted 407
7 SASI_Rn01_00184943 predicted 450
8 SASI_Rn01_00184944 predicted 392
9 SASI_Rn01_00184945 predicted 347
10 SASI_Rn01_00184946 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038142 predicted 375
2 SASI_Mm01_00038143 predicted 242
3 SASI_Mm01_00038144 predicted 257
4 SASI_Mm01_00038145 predicted 356
5 SASI_Mm01_00038146 predicted 364
6 SASI_Mm01_00038147 predicted 383
7 SASI_Mm02_00319241 predicted 374
8 SASI_Mm01_00038148 predicted 237
9 SASI_Mm02_00319242 predicted 376
10 SASI_Mm01_00038150 predicted 370
11 SASI_Mm01_00038149 predicted 300
12 SASI_Mm01_00038151 predicted 420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010742
LY6D MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 6 complex, locus D
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010742.1-530s1c1
Sequence:CCGGCCAAGAGCTGATGACATATATCTCGAGATATATGTCATCAGCTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010742.1-264s1c1
Sequence:CCGGGCTGCCAGACTGACCTATGCACTCGAGTGCATAGGTCAGTCTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010742.1-109s1c1
Sequence:CCGGCCCTCAGGTCTGCCCGTCCAACTCGAGTTGGACGGGCAGACCTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010742.1-232s1c1
Sequence:CCGGCCATGTCAGCAGTGGTTCCGACTCGAGTCGGAACCACTGCTGACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010742.1-84s1c1
Sequence:CCGGGCACCAACAGTGCCAACTGTACTCGAGTACAGTTGGCACTGTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010742.1-182s21c1
Sequence:CCGGGTGAGGAAAGAGTGTGCAAACCTCGAGGTTTGCACACTCTTTCCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010742.1-388s21c1
Sequence:CCGGGTAATGTACTGCTTGGAATTTCTCGAGAAATTCCAAGCAGTACATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010742.1-58s21c1
Sequence:CCGGAGCCTGGGCACTTCGATGTCACTCGAGTGACATCGAAGTGCCCAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010742.1-446s21c1
Sequence:CCGGGGCCCATGCTTTAGCCATGATCTCGAGATCATGGCTAAAGCATGGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010742
LY6D MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 6 complex, locus D
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010742.1-530s1c1
Sequence:CCGGCCAAGAGCTGATGACATATATCTCGAGATATATGTCATCAGCTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010742.1-264s1c1
Sequence:CCGGGCTGCCAGACTGACCTATGCACTCGAGTGCATAGGTCAGTCTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010742.1-109s1c1
Sequence:CCGGCCCTCAGGTCTGCCCGTCCAACTCGAGTTGGACGGGCAGACCTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010742.1-232s1c1
Sequence:CCGGCCATGTCAGCAGTGGTTCCGACTCGAGTCGGAACCACTGCTGACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010742.1-84s1c1
Sequence:CCGGGCACCAACAGTGCCAACTGTACTCGAGTACAGTTGGCACTGTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010742.1-182s21c1
Sequence:CCGGGTGAGGAAAGAGTGTGCAAACCTCGAGGTTTGCACACTCTTTCCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010742.1-388s21c1
Sequence:CCGGGTAATGTACTGCTTGGAATTTCTCGAGAAATTCCAAGCAGTACATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010742.1-58s21c1
Sequence:CCGGAGCCTGGGCACTTCGATGTCACTCGAGTGACATCGAAGTGCCCAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010742.1-446s21c1
Sequence:CCGGGGCCCATGCTTTAGCCATGATCTCGAGATCATGGCTAAAGCATGGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010742
LY6D MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 6 complex, locus D
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010742.1-530s1c1
Sequence:CCGGCCAAGAGCTGATGACATATATCTCGAGATATATGTCATCAGCTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010742.1-264s1c1
Sequence:CCGGGCTGCCAGACTGACCTATGCACTCGAGTGCATAGGTCAGTCTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010742.1-109s1c1
Sequence:CCGGCCCTCAGGTCTGCCCGTCCAACTCGAGTTGGACGGGCAGACCTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010742.1-232s1c1
Sequence:CCGGCCATGTCAGCAGTGGTTCCGACTCGAGTCGGAACCACTGCTGACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010742.1-84s1c1
Sequence:CCGGGCACCAACAGTGCCAACTGTACTCGAGTACAGTTGGCACTGTTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010742.1-182s21c1
Sequence:CCGGGTGAGGAAAGAGTGTGCAAACCTCGAGGTTTGCACACTCTTTCCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010742.1-388s21c1
Sequence:CCGGGTAATGTACTGCTTGGAATTTCTCGAGAAATTCCAAGCAGTACATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010742.1-58s21c1
Sequence:CCGGAGCCTGGGCACTTCGATGTCACTCGAGTGACATCGAAGTGCCCAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010742.1-446s21c1
Sequence:CCGGGGCCCATGCTTTAGCCATGATCTCGAGATCATGGCTAAAGCATGGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003695
LY6D MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 6 complex, locus D
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003695.2-608s21c1
Sequence:CCGGGGAATGCTGATGACTTGGAGCCTCGAGGCTCCAAGTCATCAGCATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003695.2-196s21c1
Sequence:CCGGCAGCTCTCGCTTCTGCAAGACCTCGAGGTCTTGCAGAAGCGAGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003695.2-511s21c1
Sequence:CCGGGGGATTCCACACCTCTCTTCCCTCGAGGGAAGAGAGGTGTGGAATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003695.2-162s21c1
Sequence:CCGGCCAGCAACTGCAAGCATTCTGCTCGAGCAGAATGCTTGCAGTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003695.2-246s21c1
Sequence:CCGGATCTGGTGAAGAAGGACTGTGCTCGAGCACAGTCCTTCTTCACCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003695.2-352s21c1
Sequence:CCGGCAATGAGAAGCTGCACAACGCCTCGAGGCGTTGTGCAGCTTCTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003695.2-343s21c1
Sequence:CCGGGGACCTGTGCAATGAGAAGCTCTCGAGAGCTTCTCATTGCACAGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003695.2-204s21c1
Sequence:CCGGGCTTCTGCAAGACCACGAACACTCGAGTGTTCGTGGTCTTGCAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003695
LY6D MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 6 complex, locus D
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003695.2-608s21c1
Sequence:CCGGGGAATGCTGATGACTTGGAGCCTCGAGGCTCCAAGTCATCAGCATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003695.2-196s21c1
Sequence:CCGGCAGCTCTCGCTTCTGCAAGACCTCGAGGTCTTGCAGAAGCGAGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003695.2-511s21c1
Sequence:CCGGGGGATTCCACACCTCTCTTCCCTCGAGGGAAGAGAGGTGTGGAATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003695.2-162s21c1
Sequence:CCGGCCAGCAACTGCAAGCATTCTGCTCGAGCAGAATGCTTGCAGTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003695.2-246s21c1
Sequence:CCGGATCTGGTGAAGAAGGACTGTGCTCGAGCACAGTCCTTCTTCACCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003695.2-352s21c1
Sequence:CCGGCAATGAGAAGCTGCACAACGCCTCGAGGCGTTGTGCAGCTTCTCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003695.2-343s21c1
Sequence:CCGGGGACCTGTGCAATGAGAAGCTCTCGAGAGCTTCTCATTGCACAGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003695.2-204s21c1
Sequence:CCGGGCTTCTGCAAGACCACGAACACTCGAGTGTTCGTGGTCTTGCAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003695
LY6D MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 6 complex, locus D
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003695.2-608s21c1
Sequence:CCGGGGAATGCTGATGACTTGGAGCCTCGAGGCTCCAAGTCATCAGCATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003695.2-196s21c1
Sequence:CCGGCAGCTCTCGCTTCTGCAAGACCTCGAGGTCTTGCAGAAGCGAGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003695.2-511s21c1
Sequence:CCGGGGGATTCCACACCTCTCTTCCCTCGAGGGAAGAGAGGTGTGGAATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003695.2-162s21c1
Sequence:CCGGCCAGCAACTGCAAGCATTCTGCTCGAGCAGAATGCTTGCAGTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003695.2-246s21c1
Sequence:CCGGATCTGGTGAAGAAGGACTGTGCTCGAGCACAGTCCTTCTTCACCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003695.2-352s21c1
Sequence:CCGGCAATGAGAAGCTGCACAACGCCTCGAGGCGTTGTGCAGCTTCTCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003695.2-343s21c1
Sequence:CCGGGGACCTGTGCAATGAGAAGCTCTCGAGAGCTTCTCATTGCACAGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003695.2-204s21c1
Sequence:CCGGGCTTCTGCAAGACCACGAACACTCGAGTGTTCGTGGTCTTGCAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)