EMAIL THIS PAGE TO A FRIEND

LY6E

lymphocyte antigen 6 complex, locus E

56 Gene Product Result for
Synonyms: RIG-E RIGE SCA-2 SCA2 TSA-1
UniProtKB ID: Q16553, B2R4X5, D3DWJ2, Q0VDE5
Gene ID:
Mouse(17069) lymphocyte antigen 6 complex, locus E
Rat(362934) lymphocyte antigen 6 complex, locus E
chicken(395550) lymphocyte antigen 6 complex, locus E
cow(510977) lymphocyte antigen 6 complex, locus E
dog(100683006) lymphocyte antigen 6 complex, locus E
naked mole-rat(101699978) lymphocyte antigen 6 complex, locus E
domestic guinea pig(100727466) lymphocyte antigen 6 complex, locus E
sheep(101116063) lymphocyte antigen 6 complex, locus E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002346 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008529 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008529 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008529 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU029751 MISSION® esiRNA esiRNA targeting mouse Ly6e (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127213 Rosetta Predictions human pricing
NM_002346 Rosetta Predictions human pricing
NM_001017467 Rosetta Predictions rat pricing
NM_008529 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328797 predicted 594
2 SASI_Hs02_00328798 predicted 804
3 SASI_Hs02_00328799 predicted 317
4 SASI_Hs02_00328800 predicted 431
5 SASI_Hs02_00328801 predicted 381
6 SASI_Hs02_00328802 predicted 633
7 SASI_Hs02_00328803 predicted 302
8 SASI_Hs02_00328804 predicted 313
9 SASI_Hs02_00328805 predicted 821
10 SASI_Hs02_00328806 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078562 predicted 596
2 SASI_Hs02_00333671 predicted 811
3 SASI_Hs01_00078563 predicted 317
4 SASI_Hs01_00078564 predicted 431
5 SASI_Hs01_00078565 predicted 387
6 SASI_Hs01_00078566 predicted 637
7 SASI_Hs01_00078569 predicted 312
8 SASI_Hs01_00078570 predicted 318
9 SASI_Hs02_00333672 predicted 828
10 SASI_Hs02_00333673 predicted 394
11 SASI_Hs01_00078567 predicted 777
12 SASI_Hs01_00078568 predicted 851
13 SASI_Hs01_00078571 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094611 predicted 1011
2 SASI_Rn01_00094612 predicted 360
3 SASI_Rn01_00094614 predicted 333
4 SASI_Rn01_00094615 predicted 417
5 SASI_Rn01_00094616 predicted 987
6 SASI_Rn01_00094617 predicted 949
7 SASI_Rn01_00094619 predicted 967
8 SASI_Rn01_00094620 predicted 830
9 SASI_Rn02_00202268 predicted 378
10 SASI_Rn02_00202269 predicted 561
11 SASI_Rn01_00094613 predicted 989
12 SASI_Rn01_00094618 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162865 predicted 820
2 SASI_Mm01_00162866 predicted 660
3 SASI_Mm01_00162867 predicted 703
4 SASI_Mm01_00162868 predicted 749
5 SASI_Mm01_00162869 predicted 400
6 SASI_Mm01_00162870 predicted 789
7 SASI_Mm01_00162871 predicted 821
8 SASI_Mm01_00162872 predicted 390
9 SASI_Mm01_00162873 predicted 864
10 SASI_Mm01_00162874 predicted 821
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002346
VALIDATED
LY6E MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 6 complex, locus E
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002346.2-437s21c1
Sequence:CCGGGCCAGAGCTTTCTGTGCAATTCTCGAGAATTGCACAGAAAGCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002346.2-236s21c1
Sequence:CCGGGCTTGAACCAGAAGAGCAATCCTCGAGGATTGCTCTTCTGGTTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002346.2-388s21c1
Sequence:CCGGATCCCAGAAGGCGTCAATGTTCTCGAGAACATTGACGCCTTCTGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002346.2-609s21c1
Sequence:CCGGTTCTGGATCCCACAGTGTATGCTCGAGCATACACTGTGGGATCCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002346.2-327s21c1
Sequence:CCGGCATTGGGAATCTCGTGACATTCTCGAGAATGTCACGAGATTCCCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002346.1-309s1c1
Sequence:CCGGGAATCTCGTGACATTTGGCCACTCGAGTGGCCAAATGTCACGAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002346.1-212s1c1
Sequence:CCGGGCTTGAACCAGAAGAGCAATCCTCGAGGATTGCTCTTCTGGTTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002346.1-413s1c1
Sequence:CCGGGCCAGAGCTTTCTGTGCAATTCTCGAGAATTGCACAGAAAGCTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002346.1-222s1c1
Sequence:CCGGGAAGAGCAATCTGTACTGCCTCTCGAGAGGCAGTACAGATTGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002346.1-303s1c1
Sequence:CCGGCATTGGGAATCTCGTGACATTCTCGAGAATGTCACGAGATTCCCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002346.1-414s1c1
Sequence:CCGGCCAGAGCTTTCTGTGCAATTTCTCGAGAAATTGCACAGAAAGCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002346.1-216s1c1
Sequence:CCGGGAACCAGAAGAGCAATCTGTACTCGAGTACAGATTGCTCTTCTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002346
VALIDATED
LY6E MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 6 complex, locus E
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002346.2-437s21c1
Sequence:CCGGGCCAGAGCTTTCTGTGCAATTCTCGAGAATTGCACAGAAAGCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002346.2-236s21c1
Sequence:CCGGGCTTGAACCAGAAGAGCAATCCTCGAGGATTGCTCTTCTGGTTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002346.2-388s21c1
Sequence:CCGGATCCCAGAAGGCGTCAATGTTCTCGAGAACATTGACGCCTTCTGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002346.2-609s21c1
Sequence:CCGGTTCTGGATCCCACAGTGTATGCTCGAGCATACACTGTGGGATCCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002346.2-327s21c1
Sequence:CCGGCATTGGGAATCTCGTGACATTCTCGAGAATGTCACGAGATTCCCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002346.1-309s1c1
Sequence:CCGGGAATCTCGTGACATTTGGCCACTCGAGTGGCCAAATGTCACGAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002346.1-212s1c1
Sequence:CCGGGCTTGAACCAGAAGAGCAATCCTCGAGGATTGCTCTTCTGGTTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002346.1-413s1c1
Sequence:CCGGGCCAGAGCTTTCTGTGCAATTCTCGAGAATTGCACAGAAAGCTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002346.1-222s1c1
Sequence:CCGGGAAGAGCAATCTGTACTGCCTCTCGAGAGGCAGTACAGATTGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002346.1-303s1c1
Sequence:CCGGCATTGGGAATCTCGTGACATTCTCGAGAATGTCACGAGATTCCCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002346.1-414s1c1
Sequence:CCGGCCAGAGCTTTCTGTGCAATTTCTCGAGAAATTGCACAGAAAGCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002346.1-216s1c1
Sequence:CCGGGAACCAGAAGAGCAATCTGTACTCGAGTACAGATTGCTCTTCTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002346
VALIDATED
LY6E MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 6 complex, locus E
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002346.2-437s21c1
Sequence:CCGGGCCAGAGCTTTCTGTGCAATTCTCGAGAATTGCACAGAAAGCTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002346.2-236s21c1
Sequence:CCGGGCTTGAACCAGAAGAGCAATCCTCGAGGATTGCTCTTCTGGTTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002346.2-388s21c1
Sequence:CCGGATCCCAGAAGGCGTCAATGTTCTCGAGAACATTGACGCCTTCTGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002346.2-609s21c1
Sequence:CCGGTTCTGGATCCCACAGTGTATGCTCGAGCATACACTGTGGGATCCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002346.2-327s21c1
Sequence:CCGGCATTGGGAATCTCGTGACATTCTCGAGAATGTCACGAGATTCCCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002346.1-309s1c1
Sequence:CCGGGAATCTCGTGACATTTGGCCACTCGAGTGGCCAAATGTCACGAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002346.1-212s1c1
Sequence:CCGGGCTTGAACCAGAAGAGCAATCCTCGAGGATTGCTCTTCTGGTTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002346.1-413s1c1
Sequence:CCGGGCCAGAGCTTTCTGTGCAATTCTCGAGAATTGCACAGAAAGCTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002346.1-222s1c1
Sequence:CCGGGAAGAGCAATCTGTACTGCCTCTCGAGAGGCAGTACAGATTGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002346.1-303s1c1
Sequence:CCGGCATTGGGAATCTCGTGACATTCTCGAGAATGTCACGAGATTCCCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002346.1-414s1c1
Sequence:CCGGCCAGAGCTTTCTGTGCAATTTCTCGAGAAATTGCACAGAAAGCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002346.1-216s1c1
Sequence:CCGGGAACCAGAAGAGCAATCTGTACTCGAGTACAGATTGCTCTTCTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008529
VALIDATED
LY6E MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 6 complex, locus E
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008529.2-863s1c1
Sequence:CCGGCCTGTGTGAATGAAGCCACTTCTCGAGAAGTGGCTTCATTCACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008529.2-191s1c1
Sequence:CCGGCTTCTCATGTACCGATCAGAACTCGAGTTCTGATCGGTACATGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008529.2-198s1c1
Sequence:CCGGTGTACCGATCAGAAGAACAATCTCGAGATTGTTCTTCTGATCGGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008529.2-255s1c1
Sequence:CCGGGACCATTACTGTATCACGTTACTCGAGTAACGTGATACAGTAATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008529.2-401s1c1
Sequence:CCGGCCAAAGCTCCTTCTGCAACTTCTCGAGAAGTTGCAGAAGGAGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008529
VALIDATED
LY6E MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 6 complex, locus E
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008529.2-863s1c1
Sequence:CCGGCCTGTGTGAATGAAGCCACTTCTCGAGAAGTGGCTTCATTCACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008529.2-191s1c1
Sequence:CCGGCTTCTCATGTACCGATCAGAACTCGAGTTCTGATCGGTACATGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008529.2-198s1c1
Sequence:CCGGTGTACCGATCAGAAGAACAATCTCGAGATTGTTCTTCTGATCGGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008529.2-255s1c1
Sequence:CCGGGACCATTACTGTATCACGTTACTCGAGTAACGTGATACAGTAATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008529.2-401s1c1
Sequence:CCGGCCAAAGCTCCTTCTGCAACTTCTCGAGAAGTTGCAGAAGGAGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008529
VALIDATED
LY6E MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 6 complex, locus E
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008529.2-863s1c1
Sequence:CCGGCCTGTGTGAATGAAGCCACTTCTCGAGAAGTGGCTTCATTCACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008529.2-191s1c1
Sequence:CCGGCTTCTCATGTACCGATCAGAACTCGAGTTCTGATCGGTACATGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008529.2-198s1c1
Sequence:CCGGTGTACCGATCAGAAGAACAATCTCGAGATTGTTCTTCTGATCGGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008529.2-255s1c1
Sequence:CCGGGACCATTACTGTATCACGTTACTCGAGTAACGTGATACAGTAATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008529.2-401s1c1
Sequence:CCGGCCAAAGCTCCTTCTGCAACTTCTCGAGAAGTTGCAGAAGGAGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)