EMAIL THIS PAGE TO A FRIEND

LY6G5B

lymphocyte antigen 6 complex, locus G5B

46 Gene Product Result for
Synonyms: C6orf19 G5b
Gene ID:
Human(58496) Summary: LY6G5B belongs to a cluster of leukocyte antigen-6 (LY6) genes located in the major histocompatibility complex (MHC) class III region on chromosome 6. Members of the LY6 superfamily typically contain 70 to 80 amino acids, including 8 to 10 cysteines. Most LY6 proteins are attached to the cell surface by a glycosylphosphatidylinositol (GPI) anchor that is directly involved in signal transduction (Mallya et al., 2002 [PubMed 12079290]
Mouse(266614) lymphocyte antigen 6 complex, locus G5B
Rat(406867) lymphocyte antigen 6 complex, locus G5B
sheep(101119855) lymphocyte antigen 6 complex, locus G5B
domestic guinea pig(100732220) lymphocyte antigen 6 complex, locus G5B
naked mole-rat(101707935) lymphocyte antigen 6 complex, locus G5B
cow(539236) lymphocyte antigen 6 complex, locus G5B
dog(607336) lymphocyte antigen 6 complex, locus G5B
domestic cat(101100303) lymphocyte antigen 6 complex, locus G5B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148939 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148939 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148939 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021221 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU041381 MISSION® esiRNA esiRNA targeting mouse Ly6g5b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021221 Rosetta Predictions human pricing
NM_001001934 Rosetta Predictions rat pricing
NM_148939 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075475 predicted 252
2 SASI_Hs01_00075476 predicted 492
3 SASI_Hs01_00075477 predicted 286
4 SASI_Hs01_00075478 predicted 254
5 SASI_Hs02_00354833 predicted 394
6 SASI_Hs01_00075479 predicted 517
7 SASI_Hs01_00075480 predicted 253
8 SASI_Hs01_00075482 predicted 384
9 SASI_Hs02_00354834 predicted 285
10 SASI_Hs02_00354835 predicted 199
11 SASI_Hs01_00075474 predicted 254
12 SASI_Hs01_00075481 predicted 294
13 SASI_Hs01_00075483 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001934 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115521 predicted 281
2 SASI_Rn01_00115522 predicted 264
3 SASI_Rn01_00115523 predicted 273
4 SASI_Rn01_00115524 predicted 266
5 SASI_Rn01_00115525 predicted 267
6 SASI_Rn01_00115526 predicted 278
7 SASI_Rn01_00115527 predicted 218
8 SASI_Rn02_00197949 predicted 304
9 SASI_Rn01_00115529 predicted 271
10 SASI_Rn01_00115530 predicted 264
11 SASI_Rn01_00115528 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148939 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045144 predicted 505
2 SASI_Mm01_00045145 predicted 786
3 SASI_Mm01_00045146 predicted 262
4 SASI_Mm02_00342747 predicted 219
5 SASI_Mm01_00045147 predicted 703
6 SASI_Mm01_00045148 predicted 277
7 SASI_Mm01_00045149 predicted 260
8 SASI_Mm01_00045151 predicted 223
9 SASI_Mm01_00045152 predicted 286
10 SASI_Mm01_00045153 predicted 784
11 SASI_Mm01_00045150 predicted 291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148939
LY6G5B MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 6 complex, locus G5B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148939.2-771s21c1
Sequence:CCGGGGAAACTTAAGGACGGTTCTCCTCGAGGAGAACCGTCCTTAAGTTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148939.2-224s21c1
Sequence:CCGGAGCATCATTCCTACCGATGTCCTCGAGGACATCGGTAGGAATGATGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148939.2-155s21c1
Sequence:CCGGCATCGCCGTGTATGGTGATCACTCGAGTGATCACCATACACGGCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148939.2-796s21c1
Sequence:CCGGAGGCTGACTTGACAATGAATCCTCGAGGATTCATTGTCAAGTCAGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148939.2-296s1c1
Sequence:CCGGGCCAGTACGATTACTGCAACTCTCGAGAGTTGCAGTAATCGTACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148939.2-94s1c1
Sequence:CCGGCTCTTAGAAGACCCTTCGCTACTCGAGTAGCGAAGGGTCTTCTAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148939.2-447s1c1
Sequence:CCGGCCATGCTCATAAGGTGTCTGACTCGAGTCAGACACCTTATGAGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148939.2-247s1c1
Sequence:CCGGGAAAGGCATGTGATCTACCAACTCGAGTTGGTAGATCACATGCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148939
LY6G5B MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 6 complex, locus G5B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148939.2-771s21c1
Sequence:CCGGGGAAACTTAAGGACGGTTCTCCTCGAGGAGAACCGTCCTTAAGTTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148939.2-224s21c1
Sequence:CCGGAGCATCATTCCTACCGATGTCCTCGAGGACATCGGTAGGAATGATGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148939.2-155s21c1
Sequence:CCGGCATCGCCGTGTATGGTGATCACTCGAGTGATCACCATACACGGCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148939.2-796s21c1
Sequence:CCGGAGGCTGACTTGACAATGAATCCTCGAGGATTCATTGTCAAGTCAGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148939.2-296s1c1
Sequence:CCGGGCCAGTACGATTACTGCAACTCTCGAGAGTTGCAGTAATCGTACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148939.2-94s1c1
Sequence:CCGGCTCTTAGAAGACCCTTCGCTACTCGAGTAGCGAAGGGTCTTCTAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148939.2-447s1c1
Sequence:CCGGCCATGCTCATAAGGTGTCTGACTCGAGTCAGACACCTTATGAGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148939.2-247s1c1
Sequence:CCGGGAAAGGCATGTGATCTACCAACTCGAGTTGGTAGATCACATGCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148939
LY6G5B MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 6 complex, locus G5B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148939.2-771s21c1
Sequence:CCGGGGAAACTTAAGGACGGTTCTCCTCGAGGAGAACCGTCCTTAAGTTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148939.2-224s21c1
Sequence:CCGGAGCATCATTCCTACCGATGTCCTCGAGGACATCGGTAGGAATGATGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148939.2-155s21c1
Sequence:CCGGCATCGCCGTGTATGGTGATCACTCGAGTGATCACCATACACGGCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148939.2-796s21c1
Sequence:CCGGAGGCTGACTTGACAATGAATCCTCGAGGATTCATTGTCAAGTCAGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148939.2-296s1c1
Sequence:CCGGGCCAGTACGATTACTGCAACTCTCGAGAGTTGCAGTAATCGTACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148939.2-94s1c1
Sequence:CCGGCTCTTAGAAGACCCTTCGCTACTCGAGTAGCGAAGGGTCTTCTAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148939.2-447s1c1
Sequence:CCGGCCATGCTCATAAGGTGTCTGACTCGAGTCAGACACCTTATGAGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148939.2-247s1c1
Sequence:CCGGGAAAGGCATGTGATCTACCAACTCGAGTTGGTAGATCACATGCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021221
VALIDATED
LY6G5B MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 6 complex, locus G5B
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000365363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021221.2-167s21c1
Sequence:CCGGTGGTGATCACCATCTATTATGCTCGAGCATAATAGATGGTGATCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021221.2-104s21c1
Sequence:CCGGACCCTTCTGTAGGATGCATTTCTCGAGAAATGCATCCTACAGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021221.2-291s21c1
Sequence:CCGGGTGCTGTCAGTACGATTATTGCTCGAGCAATAATCGTACTGACAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021221.2-530s21c1
Sequence:CCGGGCATGTACTTGTTCCTCAATACTCGAGTATTGAGGAACAAGTACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021221.2-82s21c1
Sequence:CCGGTGCCACTTCTGCCTCGTAGAACTCGAGTTCTACGAGGCAGAAGTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021221.2-37s21c1
Sequence:CCGGGTGGGCTTCACAGTAGGAAAGCTCGAGCTTTCCTACTGTGAAGCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021221.2-495s21c1
Sequence:CCGGCCTGAACCTGGGCTTGTCTTTCTCGAGAAAGACAAGCCCAGGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021221.2-128s21c1
Sequence:CCGGGCTCAGAGAAGTGTACCATCACTCGAGTGATGGTACACTTCTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021221.2-610s1c1
Sequence:CCGGCCACAGTGCAAATATCTTTCTCTCGAGAGAAAGATATTTGCACTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021221.1-931s1c1
Sequence:CCGGGAGGCTGTGGACAGTACATTTCTCGAGAAATGTACTGTCCACAGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021221.1-1012s1c1
Sequence:CCGGGCTGTCAGTACGATTATTGCACTCGAGTGCAATAATCGTACTGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021221.1-979s1c1
Sequence:CCGGCCTACTTTGCAGAGTACTGGTCTCGAGACCAGTACTCTGCAAAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021221.1-1112s1c1
Sequence:CCGGCCAGATTCAGTGGTTCTACCACTCGAGTGGTAGAACCACTGAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021221.1-934s1c1
Sequence:CCGGGCTGTGGACAGTACATTTCCTCTCGAGAGGAAATGTACTGTCCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021221
VALIDATED
LY6G5B MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 6 complex, locus G5B
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000365363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021221.2-167s21c1
Sequence:CCGGTGGTGATCACCATCTATTATGCTCGAGCATAATAGATGGTGATCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021221.2-104s21c1
Sequence:CCGGACCCTTCTGTAGGATGCATTTCTCGAGAAATGCATCCTACAGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021221.2-291s21c1
Sequence:CCGGGTGCTGTCAGTACGATTATTGCTCGAGCAATAATCGTACTGACAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021221.2-530s21c1
Sequence:CCGGGCATGTACTTGTTCCTCAATACTCGAGTATTGAGGAACAAGTACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021221.2-82s21c1
Sequence:CCGGTGCCACTTCTGCCTCGTAGAACTCGAGTTCTACGAGGCAGAAGTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021221.2-37s21c1
Sequence:CCGGGTGGGCTTCACAGTAGGAAAGCTCGAGCTTTCCTACTGTGAAGCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021221.2-495s21c1
Sequence:CCGGCCTGAACCTGGGCTTGTCTTTCTCGAGAAAGACAAGCCCAGGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021221.2-128s21c1
Sequence:CCGGGCTCAGAGAAGTGTACCATCACTCGAGTGATGGTACACTTCTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021221.2-610s1c1
Sequence:CCGGCCACAGTGCAAATATCTTTCTCTCGAGAGAAAGATATTTGCACTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021221.1-931s1c1
Sequence:CCGGGAGGCTGTGGACAGTACATTTCTCGAGAAATGTACTGTCCACAGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021221.1-1012s1c1
Sequence:CCGGGCTGTCAGTACGATTATTGCACTCGAGTGCAATAATCGTACTGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021221.1-979s1c1
Sequence:CCGGCCTACTTTGCAGAGTACTGGTCTCGAGACCAGTACTCTGCAAAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021221.1-1112s1c1
Sequence:CCGGCCAGATTCAGTGGTTCTACCACTCGAGTGGTAGAACCACTGAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021221.1-934s1c1
Sequence:CCGGGCTGTGGACAGTACATTTCCTCTCGAGAGGAAATGTACTGTCCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021221
VALIDATED
LY6G5B MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 6 complex, locus G5B
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000365363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021221.2-167s21c1
Sequence:CCGGTGGTGATCACCATCTATTATGCTCGAGCATAATAGATGGTGATCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021221.2-104s21c1
Sequence:CCGGACCCTTCTGTAGGATGCATTTCTCGAGAAATGCATCCTACAGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021221.2-291s21c1
Sequence:CCGGGTGCTGTCAGTACGATTATTGCTCGAGCAATAATCGTACTGACAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021221.2-530s21c1
Sequence:CCGGGCATGTACTTGTTCCTCAATACTCGAGTATTGAGGAACAAGTACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021221.2-82s21c1
Sequence:CCGGTGCCACTTCTGCCTCGTAGAACTCGAGTTCTACGAGGCAGAAGTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021221.2-37s21c1
Sequence:CCGGGTGGGCTTCACAGTAGGAAAGCTCGAGCTTTCCTACTGTGAAGCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021221.2-495s21c1
Sequence:CCGGCCTGAACCTGGGCTTGTCTTTCTCGAGAAAGACAAGCCCAGGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021221.2-128s21c1
Sequence:CCGGGCTCAGAGAAGTGTACCATCACTCGAGTGATGGTACACTTCTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021221.2-610s1c1
Sequence:CCGGCCACAGTGCAAATATCTTTCTCTCGAGAGAAAGATATTTGCACTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021221.1-931s1c1
Sequence:CCGGGAGGCTGTGGACAGTACATTTCTCGAGAAATGTACTGTCCACAGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021221.1-1012s1c1
Sequence:CCGGGCTGTCAGTACGATTATTGCACTCGAGTGCAATAATCGTACTGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021221.1-979s1c1
Sequence:CCGGCCTACTTTGCAGAGTACTGGTCTCGAGACCAGTACTCTGCAAAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021221.1-1112s1c1
Sequence:CCGGCCAGATTCAGTGGTTCTACCACTCGAGTGGTAGAACCACTGAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021221.1-934s1c1
Sequence:CCGGGCTGTGGACAGTACATTTCCTCTCGAGAGGAAATGTACTGTCCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)