EMAIL THIS PAGE TO A FRIEND

LY6G5C

lymphocyte antigen 6 complex, locus G5C

67 Gene Product Result for
Synonyms: C6orf20 G5C LY6G5CA LY6G5CB NG33
Gene ID:
Human(80741) Summary: LY6G5C belongs to a cluster of leukocyte antigen-6 (LY6) genes located in the major histocompatibility complex (MHC) class III region on chromosome 6. Members of the LY6 superfamily typically contain 70 to 80 amino acids, including 8 to 10 cysteines. Most LY6 proteins are attached to the cell surface by a glycosylphosphatidylinositol (GPI) anchor that is directly involved in signal transduction (Mallya et al., 2002 [PubMed 12079290]
Mouse(114652) lymphocyte antigen 6 complex, locus G5C
Rat(294245) lymphocyte antigen 6 complex, locus G5C
cow(100848062) lymphocyte antigen 6 complex, locus G5C
domestic cat(101100562) lymphocyte antigen 6 complex, locus G5C
dog(403793) lymphocyte antigen 6 complex, locus G5C
naked mole-rat(101714272) lymphocyte antigen 6 complex, locus G5C
domestic guinea pig(100731947) lymphocyte antigen 6 complex, locus G5C
sheep(101104100) lymphocyte antigen 6 complex, locus G5C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038690 Anti-LY6G5C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025262 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_148947 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148947 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148947 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001002849 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002849 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002849 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU006501 MISSION® esiRNA esiRNA targeting mouse Ly6g5c (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002848 Rosetta Predictions human pricing
NM_001002849 Rosetta Predictions human pricing
NM_025262 Rosetta Predictions human pricing
NM_198739 Rosetta Predictions rat pricing
NM_148947 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087788 predicted 441
2 SASI_Hs01_00087789 predicted 605
3 SASI_Hs01_00087790 predicted 442
4 SASI_Hs01_00087791 predicted 437
5 SASI_Hs01_00087792 predicted 537
6 SASI_Hs01_00087793 predicted 569
7 SASI_Hs01_00087794 predicted 558
8 SASI_Hs01_00087795 predicted 441
9 SASI_Hs01_00087796 predicted 471
10 SASI_Hs01_00087797 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179420 predicted 423
2 SASI_Hs01_00179421 predicted 587
3 SASI_Hs01_00179422 predicted 417
4 SASI_Hs01_00179423 predicted 420
5 SASI_Hs01_00179424 predicted 520
6 SASI_Hs01_00179425 predicted 542
7 SASI_Hs01_00179426 predicted 538
8 SASI_Hs01_00179427 predicted 426
9 SASI_Hs01_00179428 predicted 452
10 SASI_Hs01_00179429 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038533 predicted 317
2 SASI_Hs02_00358107 predicted 313
3 SASI_Hs02_00358108 predicted 355
4 SASI_Hs02_00358109 predicted 283
5 SASI_Hs01_00038534 predicted 481
6 SASI_Hs02_00358110 predicted 248
7 SASI_Hs01_00038536 predicted 314
8 SASI_Hs02_00358111 predicted 196
9 SASI_Hs01_00038537 predicted 420
10 SASI_Hs01_00038538 predicted 446
11 SASI_Hs01_00038535 predicted 322
12 SASI_Hs01_00038539 predicted 451
13 SASI_Hs01_00038540 predicted 331
14 SASI_Hs01_00038541 predicted 355
15 SASI_Hs01_00038542 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044047 predicted 400
2 SASI_Rn01_00044048 predicted 416
3 SASI_Rn01_00044049 predicted 323
4 SASI_Rn01_00044050 predicted 248
5 SASI_Rn01_00044051 predicted 425
6 SASI_Rn01_00044052 predicted 327
7 SASI_Rn01_00044053 predicted 324
8 SASI_Rn01_00044054 predicted 385
9 SASI_Rn01_00044056 predicted 301
10 SASI_Rn02_00269963 predicted 310
11 SASI_Rn01_00044055 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148947 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164745 predicted 326
2 SASI_Mm01_00164746 predicted 330
3 SASI_Mm01_00164748 predicted 144
4 SASI_Mm01_00164749 predicted 328
5 SASI_Mm01_00164750 predicted 150
6 SASI_Mm01_00164751 predicted 105
7 SASI_Mm01_00164752 predicted 98
8 SASI_Mm01_00164753 predicted 139
9 SASI_Mm01_00164754 predicted 149
10 SASI_Mm02_00342771 predicted 117
11 SASI_Mm01_00164747 predicted 69
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025262
VALIDATED
LY6G5C MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 6 complex, locus G5C
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025262.1-335s1c1
Sequence:CCGGGTGATTGTTCAAATACCCGAACTCGAGTTCGGGTATTTGAACAATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025262.2-451s21c1
Sequence:CCGGTGCAGCAAACTTTGGTGTAAACTCGAGTTTACACCAAAGTTTGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025262.2-188s21c1
Sequence:CCGGTCTTGGAGACCAAGGAGTTAGCTCGAGCTAACTCCTTGGTCTCCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_025262.2-393s1c1
Sequence:CCGGCTTCCTGGATTTCTGCAATGACTCGAGTCATTGCAGAAATCCAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025262.2-301s21c1
Sequence:CCGGGTGAGTGACTGCCGAAGTAAGCTCGAGCTTACTTCGGCAGTCACTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025262.2-424s21c1
Sequence:CCGGAGAGGGCTCTATACTCCTTAGCTCGAGCTAAGGAGTATAGAGCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025262
VALIDATED
LY6G5C MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 6 complex, locus G5C
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025262.1-335s1c1
Sequence:CCGGGTGATTGTTCAAATACCCGAACTCGAGTTCGGGTATTTGAACAATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025262.2-451s21c1
Sequence:CCGGTGCAGCAAACTTTGGTGTAAACTCGAGTTTACACCAAAGTTTGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025262.2-188s21c1
Sequence:CCGGTCTTGGAGACCAAGGAGTTAGCTCGAGCTAACTCCTTGGTCTCCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_025262.2-393s1c1
Sequence:CCGGCTTCCTGGATTTCTGCAATGACTCGAGTCATTGCAGAAATCCAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025262.2-301s21c1
Sequence:CCGGGTGAGTGACTGCCGAAGTAAGCTCGAGCTTACTTCGGCAGTCACTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025262.2-424s21c1
Sequence:CCGGAGAGGGCTCTATACTCCTTAGCTCGAGCTAAGGAGTATAGAGCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025262
VALIDATED
LY6G5C MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 6 complex, locus G5C
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025262.1-335s1c1
Sequence:CCGGGTGATTGTTCAAATACCCGAACTCGAGTTCGGGTATTTGAACAATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025262.2-451s21c1
Sequence:CCGGTGCAGCAAACTTTGGTGTAAACTCGAGTTTACACCAAAGTTTGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025262.2-188s21c1
Sequence:CCGGTCTTGGAGACCAAGGAGTTAGCTCGAGCTAACTCCTTGGTCTCCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_025262.2-393s1c1
Sequence:CCGGCTTCCTGGATTTCTGCAATGACTCGAGTCATTGCAGAAATCCAGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025262.2-301s21c1
Sequence:CCGGGTGAGTGACTGCCGAAGTAAGCTCGAGCTTACTTCGGCAGTCACTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025262.2-424s21c1
Sequence:CCGGAGAGGGCTCTATACTCCTTAGCTCGAGCTAAGGAGTATAGAGCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148947
LY6G5C MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 6 complex, locus G5C
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148947.1-111s1c1
Sequence:CCGGCTTGGTTCTCGGTGATACCAACTCGAGTTGGTATCACCGAGAACCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148947.1-276s1c1
Sequence:CCGGCATAAAGAACAGCAGCGGTTTCTCGAGAAACCGCTGCTGTTCTTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148947.1-160s1c1
Sequence:CCGGCCACTAAACAAGTACCTGAATCTCGAGATTCAGGTACTTGTTTAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148947.1-153s1c1
Sequence:CCGGGTCCCTCCCACTAAACAAGTACTCGAGTACTTGTTTAGTGGGAGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148947.1-173s21c1
Sequence:CCGGACCTGAATTGCTACCGATGTCCTCGAGGACATCGGTAGCAATTCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148947.1-84s1c1
Sequence:CCGGCCTCTTAACAGTGCTGGTCATCTCGAGATGACCAGCACTGTTAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148947.1-261s21c1
Sequence:CCGGCTGTGTCACCCTGCACATAAACTCGAGTTTATGTGCAGGGTGACACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148947
LY6G5C MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 6 complex, locus G5C
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148947.1-111s1c1
Sequence:CCGGCTTGGTTCTCGGTGATACCAACTCGAGTTGGTATCACCGAGAACCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148947.1-276s1c1
Sequence:CCGGCATAAAGAACAGCAGCGGTTTCTCGAGAAACCGCTGCTGTTCTTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148947.1-160s1c1
Sequence:CCGGCCACTAAACAAGTACCTGAATCTCGAGATTCAGGTACTTGTTTAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148947.1-153s1c1
Sequence:CCGGGTCCCTCCCACTAAACAAGTACTCGAGTACTTGTTTAGTGGGAGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148947.1-173s21c1
Sequence:CCGGACCTGAATTGCTACCGATGTCCTCGAGGACATCGGTAGCAATTCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148947.1-84s1c1
Sequence:CCGGCCTCTTAACAGTGCTGGTCATCTCGAGATGACCAGCACTGTTAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148947.1-261s21c1
Sequence:CCGGCTGTGTCACCCTGCACATAAACTCGAGTTTATGTGCAGGGTGACACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148947
LY6G5C MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 6 complex, locus G5C
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148947.1-111s1c1
Sequence:CCGGCTTGGTTCTCGGTGATACCAACTCGAGTTGGTATCACCGAGAACCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148947.1-276s1c1
Sequence:CCGGCATAAAGAACAGCAGCGGTTTCTCGAGAAACCGCTGCTGTTCTTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148947.1-160s1c1
Sequence:CCGGCCACTAAACAAGTACCTGAATCTCGAGATTCAGGTACTTGTTTAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148947.1-153s1c1
Sequence:CCGGGTCCCTCCCACTAAACAAGTACTCGAGTACTTGTTTAGTGGGAGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148947.1-173s21c1
Sequence:CCGGACCTGAATTGCTACCGATGTCCTCGAGGACATCGGTAGCAATTCAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148947.1-84s1c1
Sequence:CCGGCCTCTTAACAGTGCTGGTCATCTCGAGATGACCAGCACTGTTAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148947.1-261s21c1
Sequence:CCGGCTGTGTCACCCTGCACATAAACTCGAGTTTATGTGCAGGGTGACACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002849
LY6G5C MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 6 complex, locus G5C
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000144843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002849.1-462s1c1
Sequence:CCGGGCTTCTGGATATTCTCTCAATCTCGAGATTGAGAGAATATCCAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002849.1-544s1c1
Sequence:CCGGCTGCAGCAAACTTTGGTGTAACTCGAGTTACACCAAAGTTTGCTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002849.1-96s1c1
Sequence:CCGGGATGAGCTTGGTGTTTGGTAACTCGAGTTACCAAACACCAAGCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002849.1-494s1c1
Sequence:CCGGGATTTCTGCAATGACCCTCAACTCGAGTTGAGGGTCATTGCAGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002849
LY6G5C MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 6 complex, locus G5C
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000144843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002849.1-462s1c1
Sequence:CCGGGCTTCTGGATATTCTCTCAATCTCGAGATTGAGAGAATATCCAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002849.1-544s1c1
Sequence:CCGGCTGCAGCAAACTTTGGTGTAACTCGAGTTACACCAAAGTTTGCTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002849.1-96s1c1
Sequence:CCGGGATGAGCTTGGTGTTTGGTAACTCGAGTTACCAAACACCAAGCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002849.1-494s1c1
Sequence:CCGGGATTTCTGCAATGACCCTCAACTCGAGTTGAGGGTCATTGCAGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002849
LY6G5C MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 6 complex, locus G5C
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000144843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002849.1-462s1c1
Sequence:CCGGGCTTCTGGATATTCTCTCAATCTCGAGATTGAGAGAATATCCAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141299    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002849.1-544s1c1
Sequence:CCGGCTGCAGCAAACTTTGGTGTAACTCGAGTTACACCAAAGTTTGCTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002849.1-96s1c1
Sequence:CCGGGATGAGCTTGGTGTTTGGTAACTCGAGTTACCAAACACCAAGCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002849.1-494s1c1
Sequence:CCGGGATTTCTGCAATGACCCTCAACTCGAGTTGAGGGTCATTGCAGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)