EMAIL THIS PAGE TO A FRIEND

LY6G6D

lymphocyte antigen 6 complex, locus G6D

42 Gene Product Result for
Synonyms: C6orf23 G6D LY6-D MEGT1 NG25
UniProtKB ID: O95868, A2BEY8, B0UXC1, B0V019, B0V1Y6, Q4VX50
Gene ID:
Human(58530) Summary: LY6G6D belongs to a cluster of leukocyte antigen-6 (LY6) genes located in the major histocompatibility complex (MHC) class III region on chromosome 6. Members of the LY6 superfamily typically contain 70 to 80 amino acids, including 8 to 10 cysteines. Most LY6 proteins are attached to the cell surface by a glycosylphosphatidylinositol (GPI) anchor that is directly involved in signal transduction (Mallya et al., 2002 [PubMed 12079290]
Mouse(114654) lymphocyte antigen 6 complex, locus G6D
Rat(415062) lymphocyte antigen 6 complex, locus G6D
cow(100847486) lymphocyte antigen 6 complex, locus G6D
naked mole-rat(101705143) lymphocyte antigen 6 complex, locus G6D
domestic guinea pig(100721264) lymphocyte antigen 6 complex, locus G6D
sheep(101119341) lymphocyte antigen 6 complex, locus G6D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021246 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021246 Rosetta Predictions human pricing
NM_001001970 Rosetta Predictions rat pricing
NM_033478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121246 predicted 59
2 SASI_Hs01_00121247 predicted 55
3 SASI_Hs01_00121248 predicted 152
4 SASI_Hs01_00121249 predicted 223
5 SASI_Hs01_00121250 predicted 176
6 SASI_Hs01_00121251 predicted 256
7 SASI_Hs01_00121252 predicted 176
8 SASI_Hs01_00121253 predicted 298
9 SASI_Hs01_00121254 predicted 368
10 SASI_Hs01_00121255 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112941 predicted 261
2 SASI_Rn01_00112942 predicted 261
3 SASI_Rn01_00112943 predicted 226
4 SASI_Rn01_00112944 predicted 253
5 SASI_Rn01_00112945 predicted 182
6 SASI_Rn02_00197952 predicted 100
7 SASI_Rn01_00112946 predicted 229
8 SASI_Rn01_00112947 predicted 139
9 SASI_Rn01_00112948 predicted 156
10 SASI_Rn01_00112949 predicted 191
11 SASI_Rn01_00112950 predicted 100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127492 predicted 216
2 SASI_Mm01_00127493 predicted 232
3 SASI_Mm01_00127494 predicted 223
4 SASI_Mm01_00127495 predicted 254
5 SASI_Mm01_00127496 predicted 258
6 SASI_Mm01_00127497 predicted 216
7 SASI_Mm01_00127498 predicted 227
8 SASI_Mm01_00127499 predicted 316
9 SASI_Mm01_00127500 predicted 192
10 SASI_Mm01_00127501 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033478
LY6G6D MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 6 complex, locus G6D
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033478.2-264s21c1
Sequence:CCGGGTCAGTGGGAGACGTGACTTTCTCGAGAAAGTCACGTCTCCCACTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033478.2-434s21c1
Sequence:CCGGGGTAAGGACTGAAGGACCAAGCTCGAGCTTGGTCCTTCAGTCCTTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033478.1-104s1c1
Sequence:CCGGGCAAGCAGACAGTGATCACTTCTCGAGAAGTGATCACTGTCTGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033478.2-234s21c1
Sequence:CCGGCACGCATCATTGCAATCAAGTCTCGAGACTTGATTGCAATGATGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033478.1-241s1c1
Sequence:CCGGCATTGCAATCAAGTGGCCATACTCGAGTATGGCCACTTGATTGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033478.2-104s21c1
Sequence:CCGGGCAAGCAGACAGTGATCACTTCTCGAGAAGTGATCACTGTCTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033478
LY6G6D MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 6 complex, locus G6D
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033478.2-264s21c1
Sequence:CCGGGTCAGTGGGAGACGTGACTTTCTCGAGAAAGTCACGTCTCCCACTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033478.2-434s21c1
Sequence:CCGGGGTAAGGACTGAAGGACCAAGCTCGAGCTTGGTCCTTCAGTCCTTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033478.1-104s1c1
Sequence:CCGGGCAAGCAGACAGTGATCACTTCTCGAGAAGTGATCACTGTCTGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033478.2-234s21c1
Sequence:CCGGCACGCATCATTGCAATCAAGTCTCGAGACTTGATTGCAATGATGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033478.1-241s1c1
Sequence:CCGGCATTGCAATCAAGTGGCCATACTCGAGTATGGCCACTTGATTGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033478.2-104s21c1
Sequence:CCGGGCAAGCAGACAGTGATCACTTCTCGAGAAGTGATCACTGTCTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033478
LY6G6D MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 6 complex, locus G6D
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033478.2-264s21c1
Sequence:CCGGGTCAGTGGGAGACGTGACTTTCTCGAGAAAGTCACGTCTCCCACTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033478.2-434s21c1
Sequence:CCGGGGTAAGGACTGAAGGACCAAGCTCGAGCTTGGTCCTTCAGTCCTTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033478.1-104s1c1
Sequence:CCGGGCAAGCAGACAGTGATCACTTCTCGAGAAGTGATCACTGTCTGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033478.2-234s21c1
Sequence:CCGGCACGCATCATTGCAATCAAGTCTCGAGACTTGATTGCAATGATGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033478.1-241s1c1
Sequence:CCGGCATTGCAATCAAGTGGCCATACTCGAGTATGGCCACTTGATTGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033478.2-104s21c1
Sequence:CCGGGCAAGCAGACAGTGATCACTTCTCGAGAAGTGATCACTGTCTGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021246
LY6G6D MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 6 complex, locus G6D
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021246.1-582s1c1
Sequence:CCGGGAGCCGAAGACCAAGAATCATCTCGAGATGATTCTTGGTCTTCGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021246.1-55s1c1
Sequence:CCGGGACAACATGCAGGCCATCTATCTCGAGATAGATGGCCTGCATGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021246.2-186s21c1
Sequence:CCGGGACCTTGATTCACCAACATCCCTCGAGGGATGTTGGTGAATCAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021246.2-157s21c1
Sequence:CCGGCAGATCAAGCTACCTGGAAACCTCGAGGTTTCCAGGTAGCTTGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021246.2-99s21c1
Sequence:CCGGTTCTTGCAAAGAGGCCGTGACCTCGAGGTCACGGCCTCTTTGCAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021246.2-215s21c1
Sequence:CCGGTCGCAGCCCATCATTGCAATCCTCGAGGATTGCAATGATGGGCTGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021246.2-59s21c1
Sequence:CCGGACCGAATGCGGTGCTACAACTCTCGAGAGTTGTAGCACCGCATTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021246
LY6G6D MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 6 complex, locus G6D
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021246.1-582s1c1
Sequence:CCGGGAGCCGAAGACCAAGAATCATCTCGAGATGATTCTTGGTCTTCGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021246.1-55s1c1
Sequence:CCGGGACAACATGCAGGCCATCTATCTCGAGATAGATGGCCTGCATGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021246.2-186s21c1
Sequence:CCGGGACCTTGATTCACCAACATCCCTCGAGGGATGTTGGTGAATCAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021246.2-157s21c1
Sequence:CCGGCAGATCAAGCTACCTGGAAACCTCGAGGTTTCCAGGTAGCTTGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021246.2-99s21c1
Sequence:CCGGTTCTTGCAAAGAGGCCGTGACCTCGAGGTCACGGCCTCTTTGCAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021246.2-215s21c1
Sequence:CCGGTCGCAGCCCATCATTGCAATCCTCGAGGATTGCAATGATGGGCTGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021246.2-59s21c1
Sequence:CCGGACCGAATGCGGTGCTACAACTCTCGAGAGTTGTAGCACCGCATTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021246
LY6G6D MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 6 complex, locus G6D
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021246.1-582s1c1
Sequence:CCGGGAGCCGAAGACCAAGAATCATCTCGAGATGATTCTTGGTCTTCGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021246.1-55s1c1
Sequence:CCGGGACAACATGCAGGCCATCTATCTCGAGATAGATGGCCTGCATGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021246.2-186s21c1
Sequence:CCGGGACCTTGATTCACCAACATCCCTCGAGGGATGTTGGTGAATCAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021246.2-157s21c1
Sequence:CCGGCAGATCAAGCTACCTGGAAACCTCGAGGTTTCCAGGTAGCTTGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021246.2-99s21c1
Sequence:CCGGTTCTTGCAAAGAGGCCGTGACCTCGAGGTCACGGCCTCTTTGCAAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021246.2-215s21c1
Sequence:CCGGTCGCAGCCCATCATTGCAATCCTCGAGGATTGCAATGATGGGCTGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021246.2-59s21c1
Sequence:CCGGACCGAATGCGGTGCTACAACTCTCGAGAGTTGTAGCACCGCATTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)