EMAIL THIS PAGE TO A FRIEND

LY6G6E

lymphocyte antigen 6 complex, locus G6E (pseudogene)

70 Gene Product Result for
Synonyms: C6orf22 G6e
Gene ID:
Mouse(70274) lymphocyte antigen 6 complex, locus G6E
Rat(406866) lymphocyte antigen 6 complex, locus G6E
cow(512743) lymphocyte antigen 6 complex, locus G6E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
APREST94169 PrEST Antigen LY6G6E Prestige Antigens Powered by Atlas Antibodies New human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027366 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027366 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027366 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024123 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024123 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024123 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001003720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU021531 MISSION® esiRNA esiRNA targeting mouse Ly6g6e (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024123 Rosetta Predictions human pricing
NR_003673 Rosetta Predictions human pricing
NM_001001972 Rosetta Predictions rat pricing
NM_027366 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069914 predicted 232
2 SASI_Hs01_00069915 predicted 126
3 SASI_Hs01_00069916 predicted 133
4 SASI_Hs01_00069917 predicted 120
5 SASI_Hs01_00069918 predicted 247
6 SASI_Hs01_00069919 predicted 118
7 SASI_Hs01_00069920 predicted 138
8 SASI_Hs01_00069921 predicted 149
9 SASI_Hs01_00069922 predicted 149
10 SASI_Hs01_00069923 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380071 predicted 222
2 SASI_Hs02_00380072 predicted 125
3 SASI_Hs02_00380073 predicted 126
4 SASI_Hs02_00380074 predicted 84
5 SASI_Hs02_00380075 predicted 109
6 SASI_Hs02_00380076 predicted 237
7 SASI_Hs02_00380077 predicted 112
8 SASI_Hs02_00380078 predicted 139
9 SASI_Hs02_00380079 predicted 142
10 SASI_Hs02_00380080 predicted 137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070340 predicted 541
2 SASI_Rn01_00070341 predicted 442
3 SASI_Rn01_00070342 predicted 521
4 SASI_Rn01_00070345 predicted 530
5 SASI_Rn01_00070346 predicted 495
6 SASI_Rn01_00070347 predicted 470
7 SASI_Rn02_00197953 predicted 347
8 SASI_Rn01_00070348 predicted 430
9 SASI_Rn01_00070349 predicted 592
10 SASI_Rn02_00197954 predicted 633
11 SASI_Rn01_00070343 predicted 262
12 SASI_Rn01_00070344 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027366 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071098 predicted 393
2 SASI_Mm01_00071099 predicted 590
3 SASI_Mm01_00071101 predicted 500
4 SASI_Mm02_00332044 predicted 652
5 SASI_Mm01_00071103 predicted 475
6 SASI_Mm01_00071104 predicted 686
7 SASI_Mm01_00071105 predicted 402
8 SASI_Mm01_00071106 predicted 728
9 SASI_Mm01_00071107 predicted 630
10 SASI_Mm02_00332045 predicted 790
11 SASI_Mm01_00071100 predicted 305
12 SASI_Mm01_00071102 predicted 375
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027366
LY6G6E MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 6 complex, locus G6E (pseudogene)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000265551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027366.1-404s21c1
Sequence:CCGGAGGAAGTCATTGAGCGGAAAGCTCGAGCTTTCCGCTCAATGACTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027366.1-735s21c1
Sequence:CCGGACCGATCCCAGTACCTCTACACTCGAGTGTAGAGGTACTGGGATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027366.1-500s21c1
Sequence:CCGGAGTGCTGTGAGCAGGACCTATCTCGAGATAGGTCCTGCTCACAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027366.1-469s21c1
Sequence:CCGGTACTGGTCACGGTCCTACTCTCTCGAGAGAGTAGGACCGTGACCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027366
LY6G6E MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 6 complex, locus G6E (pseudogene)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000265551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027366.1-404s21c1
Sequence:CCGGAGGAAGTCATTGAGCGGAAAGCTCGAGCTTTCCGCTCAATGACTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027366.1-735s21c1
Sequence:CCGGACCGATCCCAGTACCTCTACACTCGAGTGTAGAGGTACTGGGATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027366.1-500s21c1
Sequence:CCGGAGTGCTGTGAGCAGGACCTATCTCGAGATAGGTCCTGCTCACAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027366.1-469s21c1
Sequence:CCGGTACTGGTCACGGTCCTACTCTCTCGAGAGAGTAGGACCGTGACCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027366
LY6G6E MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 6 complex, locus G6E (pseudogene)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000265551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027366.1-404s21c1
Sequence:CCGGAGGAAGTCATTGAGCGGAAAGCTCGAGCTTTCCGCTCAATGACTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027366.1-735s21c1
Sequence:CCGGACCGATCCCAGTACCTCTACACTCGAGTGTAGAGGTACTGGGATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027366.1-500s21c1
Sequence:CCGGAGTGCTGTGAGCAGGACCTATCTCGAGATAGGTCCTGCTCACAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027366.1-469s21c1
Sequence:CCGGTACTGGTCACGGTCCTACTCTCTCGAGAGAGTAGGACCGTGACCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024123
LY6G6E MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 6 complex, locus G6E (pseudogene)
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000180350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024123.1-145s1c1
Sequence:CCGGGATGAAGCTTGTGGCATCAGTCTCGAGACTGATGCCACAAGCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024123.1-152s1c1
Sequence:CCGGCTTGTGGCATCAGTATTGGCACTCGAGTGCCAATACTGATGCCACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024123
LY6G6E MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 6 complex, locus G6E (pseudogene)
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000180350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024123.1-145s1c1
Sequence:CCGGGATGAAGCTTGTGGCATCAGTCTCGAGACTGATGCCACAAGCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024123.1-152s1c1
Sequence:CCGGCTTGTGGCATCAGTATTGGCACTCGAGTGCCAATACTGATGCCACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024123
LY6G6E MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 6 complex, locus G6E (pseudogene)
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000180350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024123.1-145s1c1
Sequence:CCGGGATGAAGCTTGTGGCATCAGTCTCGAGACTGATGCCACAAGCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024123.1-152s1c1
Sequence:CCGGCTTGTGGCATCAGTATTGGCACTCGAGTGCCAATACTGATGCCACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003720
LY6G6E MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 6 complex, locus G6E (pseudogene)
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000189737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003720.1-457s1c1
Sequence:CCGGGCAACCTCAGCATTCCTCTTTCTCGAGAAAGAGGAATGCTGAGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003720.1-1010s1c1
Sequence:CCGGGTGAGAAATAGAGTTCTGCTACTCGAGTAGCAGAACTCTATTTCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003720
LY6G6E MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 6 complex, locus G6E (pseudogene)
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000189737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003720.1-457s1c1
Sequence:CCGGGCAACCTCAGCATTCCTCTTTCTCGAGAAAGAGGAATGCTGAGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003720.1-1010s1c1
Sequence:CCGGGTGAGAAATAGAGTTCTGCTACTCGAGTAGCAGAACTCTATTTCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003720
LY6G6E MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 6 complex, locus G6E (pseudogene)
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000189737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003720.1-457s1c1
Sequence:CCGGGCAACCTCAGCATTCCTCTTTCTCGAGAAAGAGGAATGCTGAGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003720.1-1010s1c1
Sequence:CCGGGTGAGAAATAGAGTTCTGCTACTCGAGTAGCAGAACTCTATTTCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)