EMAIL THIS PAGE TO A FRIEND

LY6G6F

lymphocyte antigen 6 complex, locus G6F

56 Gene Product Result for
Synonyms: C6orf21 G6f LY6G6D NG32
UniProtKB ID: Q5SQ64, B0UXB7, O95869, Q7Z5H2, Q96QC7
Gene ID:
Human(259215) Summary: The human G6f protein is a type I transmembrane protein belonging to the immunoglobin (Ig) superfamily, which is comprised of cell-surface proteins involved in the immune system and cellular recognition (de Vet et al., 2003 [PubMed 12852788]
Mouse(433099) lymphocyte antigen 6 complex, locus G6F
Rat(309609) lymphocyte antigen 6 complex, locus G6F
dog(481715) lymphocyte antigen 6 complex, locus G6F
domestic cat(101100810) lymphocyte antigen 6 complex, locus G6F
cow(539920) lymphocyte antigen 6 complex, locus G6F
domestic guinea pig(100731394) lymphocyte antigen 6 complex, locus G6F
naked mole-rat(101705762) lymphocyte antigen 6 complex, locus G6F
sheep(101103850) lymphocyte antigen 6 complex, locus G6F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV44449 Anti-C6ORF21 antibody produced in rabbit IgG fraction of antiserum human
immunohistochemistry, western blot pricing
SAB2100313 Anti-C6ORF21 antibody produced in rabbit affinity isolated antibody bovine, canine, horse, human, guinea pig, rabbit
western blot pricing
SAB1305757 ANTI-LY6G6F(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163192 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163192 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163192 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001003693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003693 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128131 MISSION® esiRNA esiRNA human LY6G6F (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003693 Rosetta Predictions human pricing
NM_001003691 Rosetta Predictions rat pricing
XM_579101 Rosetta Predictions rat pricing
XM_484627 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193527 predicted 383
2 SASI_Hs02_00304322 predicted 624
3 SASI_Hs01_00193528 predicted 598
4 SASI_Hs01_00193529 predicted 369
5 SASI_Hs02_00304323 predicted 604
6 SASI_Hs01_00193531 predicted 418
7 SASI_Hs01_00193532 predicted 347
8 SASI_Hs01_00193533 predicted 362
9 SASI_Hs01_00193534 predicted 352
10 SASI_Hs01_00193535 predicted 360
11 SASI_Hs01_00193530 predicted 232
12 SASI_Hs01_00193536 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003691 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119106 predicted 239
2 SASI_Rn01_00119107 predicted 266
3 SASI_Rn01_00119108 predicted 339
4 SASI_Rn02_00198051 predicted 643
5 SASI_Rn02_00198052 predicted 509
6 SASI_Rn01_00119110 predicted 388
7 SASI_Rn01_00119111 predicted 413
8 SASI_Rn01_00119112 predicted 345
9 SASI_Rn01_00119114 predicted 224
10 SASI_Rn01_00119115 predicted 627
11 SASI_Rn01_00119109 predicted 641
12 SASI_Rn01_00119113 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00149225 predicted 243
2 SASI_Rn01_00149226 predicted 274
3 SASI_Rn01_00149227 predicted 343
4 SASI_Rn01_00149228 predicted 646
5 SASI_Rn01_00149229 predicted 394
6 SASI_Rn01_00149230 predicted 425
7 SASI_Rn01_00149231 predicted 349
8 SASI_Rn01_00149232 predicted 437
9 SASI_Rn01_00149233 predicted 230
10 SASI_Rn01_00149234 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242502 predicted 667
2 SASI_Mm01_00242503 predicted 866
3 SASI_Mm01_00242504 predicted 846
4 SASI_Mm01_00242505 predicted 857
5 SASI_Mm01_00242506 predicted 739
6 SASI_Mm01_00242507 predicted 780
7 SASI_Mm01_00242508 predicted 740
8 SASI_Mm01_00242509 predicted 872
9 SASI_Mm01_00242510 predicted 906
10 SASI_Mm01_00242511 predicted 780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163192
LY6G6F MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 6 complex, locus G6F
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163192.1-831s21c1
Sequence:CCGGAGAACCCTCAGTTCCTCATTTCTCGAGAAATGAGGAACTGAGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163192.1-339s21c1
Sequence:CCGGGTGTACTGTGATGGATCAGAACTCGAGTTCTGATCCATCACAGTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163192.1-385s21c1
Sequence:CCGGTATGACGTCTCTGTGCTTAAACTCGAGTTTAAGCACAGAGACGTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163192.1-854s21c1
Sequence:CCGGAGCCTGAAGTCCAGGTCTATGCTCGAGCATAGACCTGGACTTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163192.1-270s21c1
Sequence:CCGGGTACAAACTCTTCGGAAATTACTCGAGTAATTTCCGAAGAGTTTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163192
LY6G6F MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 6 complex, locus G6F
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163192.1-831s21c1
Sequence:CCGGAGAACCCTCAGTTCCTCATTTCTCGAGAAATGAGGAACTGAGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163192.1-339s21c1
Sequence:CCGGGTGTACTGTGATGGATCAGAACTCGAGTTCTGATCCATCACAGTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163192.1-385s21c1
Sequence:CCGGTATGACGTCTCTGTGCTTAAACTCGAGTTTAAGCACAGAGACGTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163192.1-854s21c1
Sequence:CCGGAGCCTGAAGTCCAGGTCTATGCTCGAGCATAGACCTGGACTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163192.1-270s21c1
Sequence:CCGGGTACAAACTCTTCGGAAATTACTCGAGTAATTTCCGAAGAGTTTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163192
LY6G6F MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 6 complex, locus G6F
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163192.1-831s21c1
Sequence:CCGGAGAACCCTCAGTTCCTCATTTCTCGAGAAATGAGGAACTGAGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163192.1-339s21c1
Sequence:CCGGGTGTACTGTGATGGATCAGAACTCGAGTTCTGATCCATCACAGTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163192.1-385s21c1
Sequence:CCGGTATGACGTCTCTGTGCTTAAACTCGAGTTTAAGCACAGAGACGTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163192.1-854s21c1
Sequence:CCGGAGCCTGAAGTCCAGGTCTATGCTCGAGCATAGACCTGGACTTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163192.1-270s21c1
Sequence:CCGGGTACAAACTCTTCGGAAATTACTCGAGTAATTTCCGAAGAGTTTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003693
LY6G6F MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 6 complex, locus G6F
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003693.1-577s21c1
Sequence:CCGGAGGAGCCGAAGACCAAGAATCCTCGAGGATTCTTGGTCTTCGGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003693.1-362s21c1
Sequence:CCGGACGACGTCTTGGTGCTCAAAGCTCGAGCTTTGAGCACCAAGACGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003693.1-53s21c1
Sequence:CCGGACAACATGCAGGCCATCTATGCTCGAGCATAGATGGCCTGCATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003693.1-605s21c1
Sequence:CCGGGCCTCATGACTCACAACAAAGCTCGAGCTTTGTTGTGAGTCATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003693.1-103s21c1
Sequence:CCGGTGTCCCTCACCACCTACTCTACTCGAGTAGAGTAGGTGGTGAGGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003693
LY6G6F MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 6 complex, locus G6F
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003693.1-577s21c1
Sequence:CCGGAGGAGCCGAAGACCAAGAATCCTCGAGGATTCTTGGTCTTCGGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003693.1-362s21c1
Sequence:CCGGACGACGTCTTGGTGCTCAAAGCTCGAGCTTTGAGCACCAAGACGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003693.1-53s21c1
Sequence:CCGGACAACATGCAGGCCATCTATGCTCGAGCATAGATGGCCTGCATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003693.1-605s21c1
Sequence:CCGGGCCTCATGACTCACAACAAAGCTCGAGCTTTGTTGTGAGTCATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003693.1-103s21c1
Sequence:CCGGTGTCCCTCACCACCTACTCTACTCGAGTAGAGTAGGTGGTGAGGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003693
LY6G6F MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 6 complex, locus G6F
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003693.1-577s21c1
Sequence:CCGGAGGAGCCGAAGACCAAGAATCCTCGAGGATTCTTGGTCTTCGGCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003693.1-362s21c1
Sequence:CCGGACGACGTCTTGGTGCTCAAAGCTCGAGCTTTGAGCACCAAGACGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003693.1-53s21c1
Sequence:CCGGACAACATGCAGGCCATCTATGCTCGAGCATAGATGGCCTGCATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003693.1-605s21c1
Sequence:CCGGGCCTCATGACTCACAACAAAGCTCGAGCTTTGTTGTGAGTCATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003693.1-103s21c1
Sequence:CCGGTGTCCCTCACCACCTACTCTACTCGAGTAGAGTAGGTGGTGAGGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)