EMAIL THIS PAGE TO A FRIEND

LY6K

lymphocyte antigen 6 complex, locus K

33 Gene Product Result for
Synonyms: CT97 HSJ001348 ly-6K
UniProtKB ID: Q17RY6, G3V116, O15227, Q9BVD7
Gene ID:
Mouse(76486) lymphocyte antigen 6 complex, locus K
Rat(100363492) lymphocyte antigen 6 complex, locus K
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017527 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_354933 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_354933 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_354933 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017527 Rosetta Predictions human pricing
NM_029627 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154794 predicted 1055
2 SASI_Hs02_00350149 predicted 797
3 SASI_Hs01_00154795 predicted 1269
4 SASI_Hs01_00154796 predicted 609
5 SASI_Hs01_00154797 predicted 1055
6 SASI_Hs01_00154798 predicted 1286
7 SASI_Hs01_00154799 predicted 1208
8 SASI_Hs01_00154800 predicted 580
9 SASI_Hs01_00154801 predicted 957
10 SASI_Hs01_00154803 predicted 795
11 SASI_Hs01_00154802 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074290 predicted 520
2 SASI_Mm01_00074291 predicted 521
3 SASI_Mm01_00074292 predicted 465
4 SASI_Mm01_00074293 predicted 461
5 SASI_Mm01_00074294 predicted 407
6 SASI_Mm01_00074295 predicted 433
7 SASI_Mm01_00074296 predicted 381
8 SASI_Mm01_00074297 predicted 520
9 SASI_Mm01_00074298 predicted 384
10 SASI_Mm01_00074299 predicted 346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017527
LY6K MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 6 complex, locus K
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017527.2-602s1c1
Sequence:CCGGACAGAGCCATACTGCGTTATACTCGAGTATAACGCAGTATGGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017527.3-515s21c1
Sequence:CCGGGAACGGACGAGGGTGACAATACTCGAGTATTGTCACCCTCGTCCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017527.2-802s1c1
Sequence:CCGGCTCATCAGTGTTCAAAGAATACTCGAGTATTCTTTGAACACTGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017527.2-793s1c1
Sequence:CCGGACCTATCAACTCATCAGTGTTCTCGAGAACACTGATGAGTTGATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017527.2-974s1c1
Sequence:CCGGCCTGTTGCATTAAACTTGTTTCTCGAGAAACAAGTTTAATGCAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017527.2-543s1c1
Sequence:CCGGGTCATGTTTGTGAGAGAGAAACTCGAGTTTCTCTCTCACAAACATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017527.3-1157s21c1
Sequence:CCGGATCAAACCTTGTAACTCATTTCTCGAGAAATGAGTTACAAGGTTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017527
LY6K MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 6 complex, locus K
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017527.2-602s1c1
Sequence:CCGGACAGAGCCATACTGCGTTATACTCGAGTATAACGCAGTATGGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017527.3-515s21c1
Sequence:CCGGGAACGGACGAGGGTGACAATACTCGAGTATTGTCACCCTCGTCCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017527.2-802s1c1
Sequence:CCGGCTCATCAGTGTTCAAAGAATACTCGAGTATTCTTTGAACACTGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017527.2-793s1c1
Sequence:CCGGACCTATCAACTCATCAGTGTTCTCGAGAACACTGATGAGTTGATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017527.2-974s1c1
Sequence:CCGGCCTGTTGCATTAAACTTGTTTCTCGAGAAACAAGTTTAATGCAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017527.2-543s1c1
Sequence:CCGGGTCATGTTTGTGAGAGAGAAACTCGAGTTTCTCTCTCACAAACATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017527.3-1157s21c1
Sequence:CCGGATCAAACCTTGTAACTCATTTCTCGAGAAATGAGTTACAAGGTTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017527
LY6K MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 6 complex, locus K
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017527.2-602s1c1
Sequence:CCGGACAGAGCCATACTGCGTTATACTCGAGTATAACGCAGTATGGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017527.3-515s21c1
Sequence:CCGGGAACGGACGAGGGTGACAATACTCGAGTATTGTCACCCTCGTCCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017527.2-802s1c1
Sequence:CCGGCTCATCAGTGTTCAAAGAATACTCGAGTATTCTTTGAACACTGATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017527.2-793s1c1
Sequence:CCGGACCTATCAACTCATCAGTGTTCTCGAGAACACTGATGAGTTGATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017527.2-974s1c1
Sequence:CCGGCCTGTTGCATTAAACTTGTTTCTCGAGAAACAAGTTTAATGCAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017527.2-543s1c1
Sequence:CCGGGTCATGTTTGTGAGAGAGAAACTCGAGTTTCTCTCTCACAAACATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017527.3-1157s21c1
Sequence:CCGGATCAAACCTTGTAACTCATTTCTCGAGAAATGAGTTACAAGGTTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_354933
LY6K MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 6 complex, locus K
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354933.1-193s1c1
Sequence:CCGGCGTTTCTTCTATGTGTCGAAACTCGAGTTTCGACACATAGAAGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354933.1-274s1c1
Sequence:CCGGGAGCCTAAGGAGTTTCTGATACTCGAGTATCAGAAACTCCTTAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354933.1-402s1c1
Sequence:CCGGTGGGAGAAGACATAGATACATCTCGAGATGTATCTATGTCTTCTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354933.1-277s1c1
Sequence:CCGGCCTAAGGAGTTTCTGATAGAACTCGAGTTCTATCAGAAACTCCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354933.1-426s1c1
Sequence:CCGGGCTGTTACTGACTGGCTTCATCTCGAGATGAAGCCAGTCAGTAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_354933
LY6K MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 6 complex, locus K
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354933.1-193s1c1
Sequence:CCGGCGTTTCTTCTATGTGTCGAAACTCGAGTTTCGACACATAGAAGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354933.1-274s1c1
Sequence:CCGGGAGCCTAAGGAGTTTCTGATACTCGAGTATCAGAAACTCCTTAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354933.1-402s1c1
Sequence:CCGGTGGGAGAAGACATAGATACATCTCGAGATGTATCTATGTCTTCTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354933.1-277s1c1
Sequence:CCGGCCTAAGGAGTTTCTGATAGAACTCGAGTTCTATCAGAAACTCCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354933.1-426s1c1
Sequence:CCGGGCTGTTACTGACTGGCTTCATCTCGAGATGAAGCCAGTCAGTAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_354933
LY6K MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 6 complex, locus K
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354933.1-193s1c1
Sequence:CCGGCGTTTCTTCTATGTGTCGAAACTCGAGTTTCGACACATAGAAGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354933.1-274s1c1
Sequence:CCGGGAGCCTAAGGAGTTTCTGATACTCGAGTATCAGAAACTCCTTAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354933.1-402s1c1
Sequence:CCGGTGGGAGAAGACATAGATACATCTCGAGATGTATCTATGTCTTCTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354933.1-277s1c1
Sequence:CCGGCCTAAGGAGTTTCTGATAGAACTCGAGTTCTATCAGAAACTCCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354933.1-426s1c1
Sequence:CCGGGCTGTTACTGACTGGCTTCATCTCGAGATGAAGCCAGTCAGTAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)