EMAIL THIS PAGE TO A FRIEND

LY75

lymphocyte antigen 75

152 Gene Product Result for
Synonyms: CD205 CLEC13B DEC-205 GP200-MR6 LY-75
UniProtKB ID: O60449, O75913, Q53R46, Q53TF5, Q7Z575, Q7Z577
Gene ID:
Mouse(17076) lymphocyte antigen 75
Rat(499800) lymphocyte antigen 75
sheep(101109941) lymphocyte antigen 75
domestic guinea pig(100723042) lymphocyte antigen 75
naked mole-rat(101702684) lymphocyte antigen 75
Zebrafish(504036) lymphocyte antigen 75
chicken(424192) lymphocyte antigen 75
cow(407236) lymphocyte antigen 75
domestic cat(100101125) lymphocyte antigen 75
dog(488366) lymphocyte antigen 75
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002349 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU082621 MISSION® esiRNA esiRNA targeting mouse Ly75 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002349 Rosetta Predictions human pricing
XM_001068965 Rosetta Predictions rat pricing
XM_575139 Rosetta Predictions rat pricing
NM_013825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100710 predicted 3082
2 SASI_Hs01_00100711 predicted 515
3 SASI_Hs02_00333675 predicted 5261
4 SASI_Hs01_00100714 predicted 3038
5 SASI_Hs02_00333676 predicted 1423
6 SASI_Hs01_00100715 predicted 1632
7 SASI_Hs01_00100716 predicted 3162
8 SASI_Hs01_00100719 predicted 2326
9 SASI_Hs02_00333677 predicted 3177
10 SASI_Hs02_00333678 predicted 4053
11 SASI_Hs01_00100712 predicted 2786
12 SASI_Hs01_00100713 predicted 4334
13 SASI_Hs01_00100717 predicted 3069
14 SASI_Hs01_00100718 predicted 3408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326421 predicted 4756
2 SASI_Rn02_00326422 predicted 3129
3 SASI_Rn02_00326423 predicted 4503
4 SASI_Rn02_00326424 predicted 4496
5 SASI_Rn02_00326425 predicted 4203
6 SASI_Rn02_00326426 predicted 2209
7 SASI_Rn02_00326427 predicted 1096
8 SASI_Rn02_00326428 predicted 4801
9 SASI_Rn02_00326429 predicted 3325
10 SASI_Rn02_00326430 predicted 1974
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403146 predicted 4670
2 SASI_Rn02_00403147 predicted 4747
3 SASI_Rn02_00403148 predicted 1112
4 SASI_Rn02_00403149 predicted 4507
5 SASI_Rn02_00403150 predicted 4488
6 SASI_Rn02_00403151 predicted 4209
7 SASI_Rn02_00403152 predicted 1093
8 SASI_Rn02_00403153 predicted 4368
9 SASI_Rn02_00403154 predicted 4798
10 SASI_Rn02_00403155 predicted 4193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163465 predicted 3139
2 SASI_Mm01_00163467 predicted 4683
3 SASI_Mm02_00322804 predicted 3877
4 SASI_Mm02_00322805 predicted 1251
5 SASI_Mm01_00163468 predicted 4157
6 SASI_Mm01_00163469 predicted 1975
7 SASI_Mm01_00163470 predicted 2689
8 SASI_Mm01_00163471 predicted 2254
9 SASI_Mm01_00163472 predicted 1108
10 SASI_Mm01_00163473 predicted 1473
11 SASI_Mm01_00163466 predicted 776
12 SASI_Mm01_00163474 predicted 882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002349
LY75 MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 75
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002349.2-5516s21c1
Sequence:CCGGGTGATTGGTAACTAGGATATGCTCGAGCATATCCTAGTTACCAATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002349.2-5408s21c1
Sequence:CCGGCCATGTTTATCACCCTAATTACTCGAGTAATTAGGGTGATAAACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002349.1-4615s1c1
Sequence:CCGGCCCGTCTTACATATTCATCAACTCGAGTTGATGAATATGTAAGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002349.1-637s1c1
Sequence:CCGGCCACCACCTTAAATTATGAATCTCGAGATTCATAATTTAAGGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002349.1-2532s1c1
Sequence:CCGGGCTGATCTTCACCTAAACTATCTCGAGATAGTTTAGGTGAAGATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002349.1-5105s1c1
Sequence:CCGGCGGACTGATTTGGTTCCTCTTCTCGAGAAGAGGAACCAAATCAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002349.1-3234s1c1
Sequence:CCGGGCCCTAATACTCAACCTCCAACTCGAGTTGGAGGTTGAGTATTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002349
LY75 MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 75
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002349.2-5516s21c1
Sequence:CCGGGTGATTGGTAACTAGGATATGCTCGAGCATATCCTAGTTACCAATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002349.2-5408s21c1
Sequence:CCGGCCATGTTTATCACCCTAATTACTCGAGTAATTAGGGTGATAAACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002349.1-4615s1c1
Sequence:CCGGCCCGTCTTACATATTCATCAACTCGAGTTGATGAATATGTAAGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002349.1-637s1c1
Sequence:CCGGCCACCACCTTAAATTATGAATCTCGAGATTCATAATTTAAGGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002349.1-2532s1c1
Sequence:CCGGGCTGATCTTCACCTAAACTATCTCGAGATAGTTTAGGTGAAGATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002349.1-5105s1c1
Sequence:CCGGCGGACTGATTTGGTTCCTCTTCTCGAGAAGAGGAACCAAATCAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002349.1-3234s1c1
Sequence:CCGGGCCCTAATACTCAACCTCCAACTCGAGTTGGAGGTTGAGTATTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002349
LY75 MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 75
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002349.2-5516s21c1
Sequence:CCGGGTGATTGGTAACTAGGATATGCTCGAGCATATCCTAGTTACCAATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002349.2-5408s21c1
Sequence:CCGGCCATGTTTATCACCCTAATTACTCGAGTAATTAGGGTGATAAACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002349.1-4615s1c1
Sequence:CCGGCCCGTCTTACATATTCATCAACTCGAGTTGATGAATATGTAAGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002349.1-637s1c1
Sequence:CCGGCCACCACCTTAAATTATGAATCTCGAGATTCATAATTTAAGGTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002349.1-2532s1c1
Sequence:CCGGGCTGATCTTCACCTAAACTATCTCGAGATAGTTTAGGTGAAGATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002349.1-5105s1c1
Sequence:CCGGCGGACTGATTTGGTTCCTCTTCTCGAGAAGAGGAACCAAATCAGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002349.1-3234s1c1
Sequence:CCGGGCCCTAATACTCAACCTCCAACTCGAGTTGGAGGTTGAGTATTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013825
VALIDATED
LY75 MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 75
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013825.3-678s21c1
Sequence:CCGGTGGAAGTTGCTACCAATTTAACTCGAGTTAAATTGGTAGCAACTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013825.3-3583s21c1
Sequence:CCGGCTTGATGACTGCGTGATATTACTCGAGTAATATCACGCAGTCATCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013825.3-245s21c1
Sequence:CCGGAGTGCCTCGGCCTCGATATTACTCGAGTAATATCGAGGCCGAGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013825.3-778s21c1
Sequence:CCGGGCTGCCGAATTAGCCTACATTCTCGAGAATGTAGGCTAATTCGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013825.3-2495s21c1
Sequence:CCGGACTACGAAGAAGCCGTCTTATCTCGAGATAAGACGGCTTCTTCGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013825.1-3218s1c1
Sequence:CCGGGCCTTGATTCTTAATCTCAAACTCGAGTTTGAGATTAAGAATCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013825.1-4325s1c1
Sequence:CCGGGCCAGTGTTCACAACCCAAATCTCGAGATTTGGGTTGTGAACACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013825.1-4222s1c1
Sequence:CCGGGCCACAGTTCATTCCATATAACTCGAGTTATATGGAATGAACTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013825.1-812s1c1
Sequence:CCGGGCTGCCGAATTAGCCTACATTCTCGAGAATGTAGGCTAATTCGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013825.1-1825s1c1
Sequence:CCGGCGTGGCTATGTCTACTGGAAACTCGAGTTTCCAGTAGACATAGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013825
VALIDATED
LY75 MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 75
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013825.3-678s21c1
Sequence:CCGGTGGAAGTTGCTACCAATTTAACTCGAGTTAAATTGGTAGCAACTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013825.3-3583s21c1
Sequence:CCGGCTTGATGACTGCGTGATATTACTCGAGTAATATCACGCAGTCATCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013825.3-245s21c1
Sequence:CCGGAGTGCCTCGGCCTCGATATTACTCGAGTAATATCGAGGCCGAGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013825.3-778s21c1
Sequence:CCGGGCTGCCGAATTAGCCTACATTCTCGAGAATGTAGGCTAATTCGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013825.3-2495s21c1
Sequence:CCGGACTACGAAGAAGCCGTCTTATCTCGAGATAAGACGGCTTCTTCGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013825.1-3218s1c1
Sequence:CCGGGCCTTGATTCTTAATCTCAAACTCGAGTTTGAGATTAAGAATCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013825.1-4325s1c1
Sequence:CCGGGCCAGTGTTCACAACCCAAATCTCGAGATTTGGGTTGTGAACACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013825.1-4222s1c1
Sequence:CCGGGCCACAGTTCATTCCATATAACTCGAGTTATATGGAATGAACTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013825.1-812s1c1
Sequence:CCGGGCTGCCGAATTAGCCTACATTCTCGAGAATGTAGGCTAATTCGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013825.1-1825s1c1
Sequence:CCGGCGTGGCTATGTCTACTGGAAACTCGAGTTTCCAGTAGACATAGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013825
VALIDATED
LY75 MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 75
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013825.3-678s21c1
Sequence:CCGGTGGAAGTTGCTACCAATTTAACTCGAGTTAAATTGGTAGCAACTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013825.3-3583s21c1
Sequence:CCGGCTTGATGACTGCGTGATATTACTCGAGTAATATCACGCAGTCATCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013825.3-245s21c1
Sequence:CCGGAGTGCCTCGGCCTCGATATTACTCGAGTAATATCGAGGCCGAGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013825.3-778s21c1
Sequence:CCGGGCTGCCGAATTAGCCTACATTCTCGAGAATGTAGGCTAATTCGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013825.3-2495s21c1
Sequence:CCGGACTACGAAGAAGCCGTCTTATCTCGAGATAAGACGGCTTCTTCGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013825.1-3218s1c1
Sequence:CCGGGCCTTGATTCTTAATCTCAAACTCGAGTTTGAGATTAAGAATCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013825.1-4325s1c1
Sequence:CCGGGCCAGTGTTCACAACCCAAATCTCGAGATTTGGGTTGTGAACACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013825.1-4222s1c1
Sequence:CCGGGCCACAGTTCATTCCATATAACTCGAGTTATATGGAATGAACTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013825.1-812s1c1
Sequence:CCGGGCTGCCGAATTAGCCTACATTCTCGAGAATGTAGGCTAATTCGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013825.1-1825s1c1
Sequence:CCGGCGTGGCTATGTCTACTGGAAACTCGAGTTTCCAGTAGACATAGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)