EMAIL THIS PAGE TO A FRIEND

LY86-AS1

LY86 antisense RNA 1

12 Gene Product Result for
Synonyms: LY86-AS LY86AS
Species: Human LY86-AS1(285780)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173675 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173675 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173675 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173675 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233361 predicted 674
2 SASI_Hs01_00233362 predicted 950
3 SASI_Hs01_00233363 predicted 834
4 SASI_Hs01_00233364 predicted 307
5 SASI_Hs01_00233365 predicted 829
6 SASI_Hs01_00233366 predicted 932
7 SASI_Hs01_00233367 predicted 714
8 SASI_Hs01_00233368 predicted 507
9 SASI_Hs01_00233369 predicted 908
10 SASI_Hs01_00233370 predicted 140
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173675
LY86-AS1 MISSION shRNA Bacterial Glycerol Stock
LY86 antisense RNA 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173675.1-201s1c1
Sequence:CCGGGCATCTCTTCCATCTCTTATTCTCGAGAATAAGAGATGGAAGAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173675.1-424s1c1
Sequence:CCGGCCATGATTCTAAGTTTCCTGACTCGAGTCAGGAAACTTAGAATCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173675.1-139s1c1
Sequence:CCGGCACACAAAGTATTTACCCTGTCTCGAGACAGGGTAAATACTTTGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173675.1-472s1c1
Sequence:CCGGCCTGTGAAACTCCTTTGGAATCTCGAGATTCCAAAGGAGTTTCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173675.1-131s1c1
Sequence:CCGGCAGCCTTTCACACAAAGTATTCTCGAGAATACTTTGTGTGAAAGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173675
LY86-AS1 MISSION shRNA shRNA Plasmid DNA
LY86 antisense RNA 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173675.1-201s1c1
Sequence:CCGGGCATCTCTTCCATCTCTTATTCTCGAGAATAAGAGATGGAAGAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173675.1-424s1c1
Sequence:CCGGCCATGATTCTAAGTTTCCTGACTCGAGTCAGGAAACTTAGAATCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173675.1-139s1c1
Sequence:CCGGCACACAAAGTATTTACCCTGTCTCGAGACAGGGTAAATACTTTGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173675.1-472s1c1
Sequence:CCGGCCTGTGAAACTCCTTTGGAATCTCGAGATTCCAAAGGAGTTTCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173675.1-131s1c1
Sequence:CCGGCAGCCTTTCACACAAAGTATTCTCGAGAATACTTTGTGTGAAAGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173675
LY86-AS1 MISSION shRNA Lentiviral Transduction Particles
LY86 antisense RNA 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173675.1-201s1c1
Sequence:CCGGGCATCTCTTCCATCTCTTATTCTCGAGAATAAGAGATGGAAGAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173675.1-424s1c1
Sequence:CCGGCCATGATTCTAAGTTTCCTGACTCGAGTCAGGAAACTTAGAATCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173675.1-139s1c1
Sequence:CCGGCACACAAAGTATTTACCCTGTCTCGAGACAGGGTAAATACTTTGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173675.1-472s1c1
Sequence:CCGGCCTGTGAAACTCCTTTGGAATCTCGAGATTCCAAAGGAGTTTCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173675.1-131s1c1
Sequence:CCGGCAGCCTTTCACACAAAGTATTCTCGAGAATACTTTGTGTGAAAGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)