EMAIL THIS PAGE TO A FRIEND

LY86

lymphocyte antigen 86

71 Gene Product Result for
Synonyms: MD-1 MMD-1 dJ80N2.1
UniProtKB ID: O95711, Q9UQC4
Gene ID:
Mouse(17084) lymphocyte antigen 86
Rat(291359) lymphocyte antigen 86
domestic guinea pig(100719962) lymphocyte antigen 86
naked mole-rat(101714380) lymphocyte antigen 86
sheep(101108087) lymphocyte antigen 86
chicken(420872) lymphocyte antigen 86
dog(478712) lymphocyte antigen 86
domestic cat(101100719) lymphocyte antigen 86
cow(789333) lymphocyte antigen 86
cow(613856) lymphocyte antigen 86
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1576 Human MD-1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010745 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010745 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010745 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004271 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004271 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004271 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042441 MISSION® esiRNA esiRNA human LY86 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004271 Rosetta Predictions human pricing
NM_001106128 Rosetta Predictions rat pricing
NM_010745 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337248 predicted 616
2 SASI_Hs01_00050016 predicted 402
3 SASI_Hs01_00050017 predicted 295
4 SASI_Hs01_00050018 predicted 404
5 SASI_Hs01_00050019 predicted 395
6 SASI_Hs01_00050020 predicted 644
7 SASI_Hs02_00337249 predicted 615
8 SASI_Hs01_00050021 predicted 388
9 SASI_Hs01_00050022 predicted 510
10 SASI_Hs01_00050023 predicted 397
11 SASI_Hs01_00050014 predicted 247
12 SASI_Hs01_00050015 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106128 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215898 predicted 272
2 SASI_Rn02_00215899 predicted 455
3 SASI_Rn02_00215900 predicted 251
4 SASI_Rn02_00215901 predicted 434
5 SASI_Rn02_00215902 predicted 333
6 SASI_Rn02_00215903 predicted 564
7 SASI_Rn02_00215904 predicted 283
8 SASI_Rn02_00215905 predicted 410
9 SASI_Rn02_00215906 predicted 200
10 SASI_Rn02_00215907 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087157 predicted 670
2 SASI_Mm01_00087158 predicted 268
3 SASI_Mm01_00087159 predicted 596
4 SASI_Mm01_00087161 predicted 681
5 SASI_Mm01_00087162 predicted 449
6 SASI_Mm01_00087163 predicted 335
7 SASI_Mm01_00087164 predicted 341
8 SASI_Mm01_00087165 predicted 414
9 SASI_Mm01_00087166 predicted 195
10 SASI_Mm02_00319255 predicted 441
11 SASI_Mm01_00087160 predicted 568
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010745
LY86 MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 86
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010745.1-249s1c1
Sequence:CCGGGCCTTTCCATTGACCAGTGTTCTCGAGAACACTGGTCAATGGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010745.1-741s1c1
Sequence:CCGGCCCAGACCCAACAGATGTAATCTCGAGATTACATCTGTTGGGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010745.1-467s1c1
Sequence:CCGGCCTGTCAATAACCCTGGACTTCTCGAGAAGTCCAGGGTTATTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010745.1-289s1c1
Sequence:CCGGTCTCAACATTAGATTTGGCATCTCGAGATGCCAAATCTAATGTTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010745.1-274s1c1
Sequence:CCGGGCAGATCCAATCAAATCTCAACTCGAGTTGAGATTTGATTGGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010745
LY86 MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 86
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010745.1-249s1c1
Sequence:CCGGGCCTTTCCATTGACCAGTGTTCTCGAGAACACTGGTCAATGGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010745.1-741s1c1
Sequence:CCGGCCCAGACCCAACAGATGTAATCTCGAGATTACATCTGTTGGGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010745.1-467s1c1
Sequence:CCGGCCTGTCAATAACCCTGGACTTCTCGAGAAGTCCAGGGTTATTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010745.1-289s1c1
Sequence:CCGGTCTCAACATTAGATTTGGCATCTCGAGATGCCAAATCTAATGTTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010745.1-274s1c1
Sequence:CCGGGCAGATCCAATCAAATCTCAACTCGAGTTGAGATTTGATTGGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010745
LY86 MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 86
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010745.1-249s1c1
Sequence:CCGGGCCTTTCCATTGACCAGTGTTCTCGAGAACACTGGTCAATGGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010745.1-741s1c1
Sequence:CCGGCCCAGACCCAACAGATGTAATCTCGAGATTACATCTGTTGGGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010745.1-467s1c1
Sequence:CCGGCCTGTCAATAACCCTGGACTTCTCGAGAAGTCCAGGGTTATTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010745.1-289s1c1
Sequence:CCGGTCTCAACATTAGATTTGGCATCTCGAGATGCCAAATCTAATGTTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010745.1-274s1c1
Sequence:CCGGGCAGATCCAATCAAATCTCAACTCGAGTTGAGATTTGATTGGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004271
LY86 MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 86
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004271.1-408s1c1
Sequence:CCGGCCTGAATTTACTATTCCTCAGCTCGAGCTGAGGAATAGTAAATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004271.1-235s1c1
Sequence:CCGGGAATTATTCTGAGAGAGGACACTCGAGTGTCCTCTCTCAGAATAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004271.1-368s1c1
Sequence:CCGGGAAAGGAGAGCAGATTTACTACTCGAGTAGTAAATCTGCTCTCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004271.1-424s1c1
Sequence:CCGGCTCAGGGAGAATACCAGGTTTCTCGAGAAACCTGGTATTCTCCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004271.1-243s1c1
Sequence:CCGGCTGAGAGAGGACATCAAAGAGCTCGAGCTCTTTGATGTCCTCTCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004271.1-380s1c1
Sequence:CCGGGATTTACTATGCTGGGCCTGTCTCGAGACAGGCCCAGCATAGTAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004271.1-361s1c1
Sequence:CCGGGAAGAAGGAAAGGAGAGCAGACTCGAGTCTGCTCTCCTTTCCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004271.1-352s1c1
Sequence:CCGGCTTTCTGTGGAAGAAGGAAAGCTCGAGCTTTCCTTCTTCCACAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004271.1-308s1c1
Sequence:CCGGGAATTTCTCCTATCCCATCTGCTCGAGCAGATGGGATAGGAGAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004271.1-247s1c1
Sequence:CCGGGAGAGGACATCAAAGAGCTTTCTCGAGAAAGCTCTTTGATGTCCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004271
LY86 MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 86
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004271.1-408s1c1
Sequence:CCGGCCTGAATTTACTATTCCTCAGCTCGAGCTGAGGAATAGTAAATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004271.1-235s1c1
Sequence:CCGGGAATTATTCTGAGAGAGGACACTCGAGTGTCCTCTCTCAGAATAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004271.1-368s1c1
Sequence:CCGGGAAAGGAGAGCAGATTTACTACTCGAGTAGTAAATCTGCTCTCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004271.1-424s1c1
Sequence:CCGGCTCAGGGAGAATACCAGGTTTCTCGAGAAACCTGGTATTCTCCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004271.1-243s1c1
Sequence:CCGGCTGAGAGAGGACATCAAAGAGCTCGAGCTCTTTGATGTCCTCTCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004271.1-380s1c1
Sequence:CCGGGATTTACTATGCTGGGCCTGTCTCGAGACAGGCCCAGCATAGTAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004271.1-361s1c1
Sequence:CCGGGAAGAAGGAAAGGAGAGCAGACTCGAGTCTGCTCTCCTTTCCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004271.1-352s1c1
Sequence:CCGGCTTTCTGTGGAAGAAGGAAAGCTCGAGCTTTCCTTCTTCCACAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004271.1-308s1c1
Sequence:CCGGGAATTTCTCCTATCCCATCTGCTCGAGCAGATGGGATAGGAGAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004271.1-247s1c1
Sequence:CCGGGAGAGGACATCAAAGAGCTTTCTCGAGAAAGCTCTTTGATGTCCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004271
LY86 MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 86
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004271.1-408s1c1
Sequence:CCGGCCTGAATTTACTATTCCTCAGCTCGAGCTGAGGAATAGTAAATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004271.1-235s1c1
Sequence:CCGGGAATTATTCTGAGAGAGGACACTCGAGTGTCCTCTCTCAGAATAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004271.1-368s1c1
Sequence:CCGGGAAAGGAGAGCAGATTTACTACTCGAGTAGTAAATCTGCTCTCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004271.1-424s1c1
Sequence:CCGGCTCAGGGAGAATACCAGGTTTCTCGAGAAACCTGGTATTCTCCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004271.1-243s1c1
Sequence:CCGGCTGAGAGAGGACATCAAAGAGCTCGAGCTCTTTGATGTCCTCTCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004271.1-380s1c1
Sequence:CCGGGATTTACTATGCTGGGCCTGTCTCGAGACAGGCCCAGCATAGTAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004271.1-361s1c1
Sequence:CCGGGAAGAAGGAAAGGAGAGCAGACTCGAGTCTGCTCTCCTTTCCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004271.1-352s1c1
Sequence:CCGGCTTTCTGTGGAAGAAGGAAAGCTCGAGCTTTCCTTCTTCCACAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004271.1-308s1c1
Sequence:CCGGGAATTTCTCCTATCCCATCTGCTCGAGCAGATGGGATAGGAGAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004271.1-247s1c1
Sequence:CCGGGAGAGGACATCAAAGAGCTTTCTCGAGAAAGCTCTTTGATGTCCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)